BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3802544.2.1
(814 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU876164.1|BU876164 V017A02 Populus flower cDNA library ... 58 5e-007
gb|BI128256.1|BI128256 G073P27Y Populus cambium cDNA librar... 50 1e-004
gb|CK087758.1|CK087758 A020P14.3pR Hybrid aspen plasmid lib... 50 1e-004
gb|BI131440.1|BI131440 G120P89Y Populus cambium cDNA librar... 42 0.033
gb|CX658013.1|CX658013 PO01008B12 Poplar SC cDNA library Po... 42 0.033
>gb|BU876164.1|BU876164 V017A02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 540
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
|||||||||||||| |||| ||| | |||||||||||||| |||||||||||
Sbjct: 332 atgttttctggtggccttaggtacaacgtcttgttcaatgctcgaggatcatc 280
>gb|BI128256.1|BI128256 G073P27Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 517
Score = 50.1 bits (25), Expect = 1e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
|||||||||||||| |||| ||| | ||||||||||||| |||||||||||
Sbjct: 123 atgttttctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 71
Score = 42.1 bits (21), Expect = 0.033
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 317 ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 269
>gb|CK087758.1|CK087758 A020P14.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A020P14 3', mRNA sequence
Length = 794
Score = 50.1 bits (25), Expect = 1e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
|||||||||||||| |||| ||| | ||||||||||||| |||||||||||
Sbjct: 400 atgttttctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 452
Score = 42.1 bits (21), Expect = 0.033
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 206 ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 254
>gb|BI131440.1|BI131440 G120P89Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 424
Score = 42.1 bits (21), Expect = 0.033
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
||||| |||||||| |||| ||| | ||||||||||||| |||||||||||
Sbjct: 251 atgttctctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 303
Score = 42.1 bits (21), Expect = 0.033
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 57 ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 105
>gb|CX658013.1|CX658013 PO01008B12 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01008B12 5', mRNA sequence
Length = 483
Score = 42.1 bits (21), Expect = 0.033
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
|||||||||||||| |||| ||| | || |||||||||| |||||||||||
Sbjct: 114 atgttttctggtggccttaggtacaaggttttgttcaatgtccgaggatcatc 62
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,269
Number of Sequences: 369679
Number of extensions: 91269
Number of successful extensions: 24420
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24406
Number of HSP's gapped (non-prelim): 14
length of query: 814
length of database: 203,408,664
effective HSP length: 19
effective length of query: 795
effective length of database: 196,384,763
effective search space: 156125886585
effective search space used: 156125886585
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)