BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2188214.2.1
(880 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ780615.1|AJ780615 AJ780615 Populus euphratica leaf 3-6... 54 9e-006
gb|AJ771301.1|AJ771301 AJ771301 Populus euphratica leaf 3-6... 50 1e-004
gb|AJ771403.1|AJ771403 AJ771403 Populus euphratica leaf 3-6... 48 6e-004
>gb|AJ780615.1|AJ780615 AJ780615 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0000900010D02F1, mRNA sequence
Length = 675
Score = 54.0 bits (27), Expect = 9e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 735 tcccatgccttcgacatgtcacaaaccgacttggagcaaagggggca 781
|||||| |||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 375 tcccataccttagacatgtcacaaactgacttcgagcaaagagggca 421
>gb|AJ771301.1|AJ771301 AJ771301 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0001500004F10F1, mRNA sequence
Length = 564
Score = 50.1 bits (25), Expect = 1e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 735 tcccatgccttcgacatgtcacaaaccgacttggagcaaag 775
|||||| |||| |||||||||||||| ||||| ||||||||
Sbjct: 375 tcccataccttagacatgtcacaaactgacttcgagcaaag 415
>gb|AJ771403.1|AJ771403 AJ771403 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0001500006E11F1, mRNA sequence
Length = 623
Score = 48.1 bits (24), Expect = 6e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 742 ccttcgacatgtcacaaaccgacttggagcaaagggggca 781
|||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 382 ccttagacatgtcacaaactgacttcgagcaaagagggca 421
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 87,222
Number of Sequences: 369679
Number of extensions: 87222
Number of successful extensions: 26650
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26647
Number of HSP's gapped (non-prelim): 3
length of query: 880
length of database: 203,408,664
effective HSP length: 19
effective length of query: 861
effective length of database: 196,384,763
effective search space: 169087280943
effective search space used: 169087280943
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)