BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829501.2.1
(1141 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|U57410.1|PSU57410 Pinus strobus chitinase (Pschi4) gene,... 70 2e-010
gb|CF387319.1|CF387319 RTDR1_12_E06.b1_A015 Loblolly pine r... 62 5e-008
gb|CF387433.1|CF387433 RTDR1_12_E06.g1_A015 Loblolly pine r... 62 5e-008
gb|CF402695.1|CF402695 RTWW1_22_F07.b1_A015 Well-watered lo... 62 5e-008
gb|CF402721.1|CF402721 RTWW1_22_F07.g1_A015 Well-watered lo... 62 5e-008
gb|CF666076.1|CF666076 RTCNT1_20_C05.g1_A029 Root control P... 62 5e-008
gb|CF666519.1|CF666519 RTCNT1_23_H08.g1_A029 Root control P... 62 5e-008
gb|CF667167.1|CF667167 RTCNT1_28_C08.g1_A029 Root control P... 62 5e-008
gb|CF669441.1|CF669441 RTCNT1_43_H11.b1_A029 Root control P... 62 5e-008
gb|CO157933.1|CO157933 FLD1_3_D12.b1_A029 Root flooded Pinu... 62 5e-008
gb|CO159873.1|CO159873 FLD1_16_C10.g1_A029 Root flooded Pin... 62 5e-008
gb|CO160475.1|CO160475 FLD1_21_F04.b1_A029 Root flooded Pin... 62 5e-008
gb|CO160542.1|CO160542 FLD1_21_F04.g1_A029 Root flooded Pin... 62 5e-008
gb|CO162720.1|CO162720 FLD1_37_C10.b1_A029 Root flooded Pin... 62 5e-008
gb|CO162801.1|CO162801 FLD1_37_C10.g1_A029 Root flooded Pin... 62 5e-008
gb|CO163830.1|CO163830 FLD1_44_C01.b1_A029 Root flooded Pin... 62 5e-008
gb|CO163908.1|CO163908 FLD1_44_C01.g1_A029 Root flooded Pin... 62 5e-008
gb|CO165084.1|CO165084 FLD1_52_F07.b1_A029 Root flooded Pin... 62 5e-008
gb|CO165159.1|CO165159 FLD1_52_F07.g1_A029 Root flooded Pin... 62 5e-008
gb|CO166724.1|CO166724 FLD1_64_C04.b1_A029 Root flooded Pin... 62 5e-008
gb|CO167135.1|CO167135 FLD1_67_C06.b1_A029 Root flooded Pin... 62 5e-008
gb|CO167207.1|CO167207 FLD1_67_C06.g1_A029 Root flooded Pin... 62 5e-008
gb|CO167667.1|CO167667 FLD1_70_H11.b1_A029 Root flooded Pin... 62 5e-008
gb|CO172154.1|CO172154 NDL1_27_E05.g1_A029 Needles control ... 62 5e-008
gb|CO196977.1|CO196977 GEO1_3_B12.b1_A029 Root gravitropism... 62 5e-008
gb|CO197047.1|CO197047 GEO1_3_B12.g1_A029 Root gravitropism... 62 5e-008
gb|CO197540.1|CO197540 GEO1_7_E10.b1_A029 Root gravitropism... 62 5e-008
gb|CO197612.1|CO197612 GEO1_7_E10.g1_A029 Root gravitropism... 62 5e-008
gb|CO198371.1|CO198371 GEO1_13_E06.b1_A029 Root gravitropis... 62 5e-008
gb|CO200358.1|CO200358 GEO2_7_A10.b1_A032 Root gravitropism... 62 5e-008
gb|CO364991.1|CO364991 RTK1_23_B02.b1_A029 Roots minus pota... 62 5e-008
gb|CO365069.1|CO365069 RTK1_23_B02.g1_A029 Roots minus pota... 62 5e-008
gb|CO366964.1|CO366964 RTK1_31_G06.b1_A029 Roots minus pota... 62 5e-008
gb|CO367045.1|CO367045 RTK1_31_G06.g1_A029 Roots minus pota... 62 5e-008
gb|CX647196.1|CX647196 COLD1_14_F07.b1_A029 Root cold Pinus... 62 5e-008
gb|DR013674.1|DR013674 HEAT1_20_F12.g1_A029 Root at 37 C fo... 62 5e-008
gb|DR016318.1|DR016318 STRS1_9_H09.b1_A034 Shoot tip pitch ... 62 5e-008
gb|DR021485.1|DR021485 STRS1_45_B01.b1_A034 Shoot tip pitch... 62 5e-008
gb|DR023069.1|DR023069 STRS1_55_F11.b1_A034 Shoot tip pitch... 62 5e-008
gb|DR023151.1|DR023151 STRS1_55_F11.g1_A034 Shoot tip pitch... 62 5e-008
gb|DR048493.1|DR048493 RTBOR1_9_F08.b1_A029 Roots plus adde... 62 5e-008
gb|DR068847.1|DR068847 RTDK1_3_F06.b1_A029 Roots, dark Pinu... 62 5e-008
gb|DR068935.1|DR068935 RTDK1_3_F06.g1_A029 Roots, dark Pinu... 62 5e-008
gb|DR071414.1|DR071414 RTDK1_19_E08.g1_A029 Roots, dark Pin... 62 5e-008
gb|DR071614.1|DR071614 RTDK1_21_B07.b1_A029 Roots, dark Pin... 62 5e-008
gb|DR072750.1|DR072750 RTDK1_28_G11.b1_A029 Roots, dark Pin... 62 5e-008
gb|DR093284.1|DR093284 STRR1_7_F10.b1_A033 Stem Response Re... 62 5e-008
gb|DR093363.1|DR093363 STRR1_7_F10.g1_A033 Stem Response Re... 62 5e-008
gb|DR095288.1|DR095288 STRR1_20_C04.b1_A033 Stem Response R... 62 5e-008
gb|DR095362.1|DR095362 STRR1_20_C04.g1_A033 Stem Response R... 62 5e-008
gb|DR098013.1|DR098013 STRR1_38_C09.g1_A033 Stem Response R... 62 5e-008
gb|DR101527.1|DR101527 STRR1_74_A01.b1_A033 Stem Response R... 62 5e-008
gb|DR101588.1|DR101588 STRR1_74_A01.g1_A033 Stem Response R... 62 5e-008
gb|DR102596.1|DR102596 STRR1_82_G10.b1_A033 Stem Response R... 62 5e-008
gb|DR102666.1|DR102666 STRR1_82_G10.g1_A033 Stem Response R... 62 5e-008
gb|DR113014.1|DR113014 RTS1_32_H04.b1_A029 Roots minus sulf... 62 5e-008
gb|DR113083.1|DR113083 RTS1_32_H04.g1_A029 Roots minus sulf... 62 5e-008
gb|DR119276.1|DR119276 RTMG1_22_F10.b1_A029 Roots minus mag... 62 5e-008
gb|DR119362.1|DR119362 RTMG1_22_F10.g1_A029 Roots minus mag... 62 5e-008
gb|DR165667.1|DR165667 RTPHOS1_6_C08.g1_A029 Roots minus ph... 62 5e-008
gb|DR181812.1|DR181812 RTMNUT1_41_E01.b1_A029 Roots minus m... 62 5e-008
gb|DR181897.1|DR181897 RTMNUT1_41_E01.g1_A029 Roots minus m... 62 5e-008
gb|DR388282.1|DR388282 RTHG1_27_F05.b1_A029 Roots plus adde... 62 5e-008
gb|DR388718.1|DR388718 RTHG1_30_C08.b1_A029 Roots plus adde... 62 5e-008
gb|DR388723.1|DR388723 RTHG1_30_D01.b1_A029 Roots plus adde... 62 5e-008
gb|DR388804.1|DR388804 RTHG1_30_C08.g1_A029 Roots plus adde... 62 5e-008
gb|DR388809.1|DR388809 RTHG1_30_D01.g1_A029 Roots plus adde... 62 5e-008
gb|DR682690.1|DR682690 EST1072765 Normalized pine embryo li... 62 5e-008
gb|DR688027.1|DR688027 EST1078110 Normalized pine embryo li... 62 5e-008
gb|DR691227.1|DR691227 EST1081313 Normalized pine embryo li... 62 5e-008
gb|DR693000.1|DR693000 EST1083088 Normalized pine embryo li... 62 5e-008
gb|DR744243.1|DR744243 RTCU1_21_D11.b1_A029 Roots plus adde... 62 5e-008
gb|DR744313.1|DR744313 RTCU1_21_D11.g1_A029 Roots plus adde... 62 5e-008
gb|DR745479.1|DR745479 RTCU1_29_H02.g1_A029 Roots plus adde... 62 5e-008
gb|DT634553.1|DT634553 EST1149484 Normalized pine embryo li... 62 5e-008
gb|DT637563.1|DT637563 EST1152494 Normalized pine embryo li... 62 5e-008
gb|U57409.1|PSU57409 Pinus strobus chitinase (Pschi1) pseud... 62 5e-008
gb|CF387630.1|CF387630 RTDR1_19_H08.b1_A015 Loblolly pine r... 54 1e-005
gb|CF388141.1|CF388141 RTDR2_1_H11.b1_A021 Loblolly pine ro... 54 1e-005
gb|CF395319.1|CF395319 RTDS2_11_D06.b1_A021 Drought-stresse... 54 1e-005
gb|CF395520.1|CF395520 RTDS2_12_H05.b1_A021 Drought-stresse... 54 1e-005
gb|CF395564.1|CF395564 RTDS2_12_H05.g1_A021 Drought-stresse... 54 1e-005
gb|CF395868.1|CF395868 RTDS2_19_D02.b1_A021 Drought-stresse... 54 1e-005
gb|CF396510.1|CF396510 RTDS2_22_H02.g1_A021 Drought-stresse... 54 1e-005
gb|CF398531.1|CF398531 RTDS3_15_D12.b1_A022 Drought-stresse... 54 1e-005
gb|CF399019.1|CF399019 RTDS3_9_G10.b1_A022 Drought-stressed... 54 1e-005
gb|CF399075.1|CF399075 RTDS3_9_A04.b1_A022 Drought-stressed... 54 1e-005
gb|CF399080.1|CF399080 RTDS3_9_D03.b1_A022 Drought-stressed... 54 1e-005
gb|CF399164.1|CF399164 RTDS3_9_G10.g1_A022 Drought-stressed... 54 1e-005
gb|CF471547.1|CF471547 RTDS1_4_A12.b1_A015 Drought-stressed... 54 1e-005
gb|CF471658.1|CF471658 RTDS1_6_C09.b1_A015 Drought-stressed... 54 1e-005
gb|CF471773.1|CF471773 RTDS1_6_C09.g1_A015 Drought-stressed... 54 1e-005
gb|CF472136.1|CF472136 RTDS1_8_F04.g1_A015 Drought-stressed... 54 1e-005
gb|CF472976.1|CF472976 RTDS1_1_D11.b1_A015 Drought-stressed... 54 1e-005
gb|CF666451.1|CF666451 RTCNT1_23_H08.b1_A029 Root control P... 54 1e-005
gb|CF668863.1|CF668863 RTCNT1_39_D06.b1_A029 Root control P... 54 1e-005
gb|CR392715.1|CR392715 CR392715 RN Pinus pinaster cDNA clon... 54 1e-005
gb|CO158329.1|CO158329 FLD1_6_E09.b1_A029 Root flooded Pinu... 54 1e-005
gb|CO158408.1|CO158408 FLD1_6_E09.g1_A029 Root flooded Pinu... 54 1e-005
gb|CO158755.1|CO158755 FLD1_9_C03.b1_A029 Root flooded Pinu... 54 1e-005
gb|CO159100.1|CO159100 FLD1_11_G12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO159608.1|CO159608 FLD1_14_D10.g1_A029 Root flooded Pin... 54 1e-005
gb|CO160257.1|CO160257 FLD1_19_F10.g1_A029 Root flooded Pin... 54 1e-005
gb|CO160278.1|CO160278 FLD1_20_A03.b1_A029 Root flooded Pin... 54 1e-005
gb|CO160307.1|CO160307 FLD1_20_D05.b1_A029 Root flooded Pin... 54 1e-005
gb|CO160353.1|CO160353 FLD1_20_A03.g1_A029 Root flooded Pin... 54 1e-005
gb|CO160858.1|CO160858 FLD1_25_C09.b1_A029 Root flooded Pin... 54 1e-005
gb|CO161156.1|CO161156 FLD1_27_B05.b1_A029 Root flooded Pin... 54 1e-005
gb|CO161238.1|CO161238 FLD1_27_B05.g1_A029 Root flooded Pin... 54 1e-005
gb|CO161358.1|CO161358 FLD1_28_F12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO161438.1|CO161438 FLD1_28_F12.g1_A029 Root flooded Pin... 54 1e-005
gb|CO161962.1|CO161962 FLD1_32_F10.b1_A029 Root flooded Pin... 54 1e-005
gb|CO162035.1|CO162035 FLD1_32_F10.g1_A029 Root flooded Pin... 54 1e-005
gb|CO162087.1|CO162087 FLD1_33_D06.b1_A029 Root flooded Pin... 54 1e-005
gb|CO162176.1|CO162176 FLD1_33_D06.g1_A029 Root flooded Pin... 54 1e-005
gb|CO162232.1|CO162232 FLD1_34_B08.b1_A029 Root flooded Pin... 54 1e-005
gb|CO162580.1|CO162580 FLD1_36_E10.b1_A029 Root flooded Pin... 54 1e-005
gb|CO162740.1|CO162740 FLD1_37_E11.b1_A029 Root flooded Pin... 54 1e-005
gb|CO163063.1|CO163063 FLD1_39_E12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO163143.1|CO163143 FLD1_39_E12.g1_A029 Root flooded Pin... 54 1e-005
gb|CO163451.1|CO163451 FLD1_41_F05.g1_A029 Root flooded Pin... 54 1e-005
gb|CO163744.1|CO163744 FLD1_43_B08.g1_A029 Root flooded Pin... 54 1e-005
gb|CO164020.1|CO164020 FLD1_45_F12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO164024.1|CO164024 FLD1_45_G06.b1_A029 Root flooded Pin... 54 1e-005
gb|CO164097.1|CO164097 FLD1_45_F12.g1_A029 Root flooded Pin... 54 1e-005
gb|CO164101.1|CO164101 FLD1_45_G06.g1_A029 Root flooded Pin... 54 1e-005
gb|CO164309.1|CO164309 FLD1_47_E02.b1_A029 Root flooded Pin... 54 1e-005
gb|CO164912.1|CO164912 FLD1_51_C09.b1_A029 Root flooded Pin... 54 1e-005
gb|CO164944.1|CO164944 FLD1_51_G03.b1_A029 Root flooded Pin... 54 1e-005
gb|CO164986.1|CO164986 FLD1_51_C09.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165020.1|CO165020 FLD1_51_G03.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165188.1|CO165188 FLD1_53_A04.b1_A029 Root flooded Pin... 54 1e-005
gb|CO165263.1|CO165263 FLD1_53_A04.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165287.1|CO165287 FLD1_53_C06.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165406.1|CO165406 FLD1_54_G11.b1_A029 Root flooded Pin... 54 1e-005
gb|CO165590.1|CO165590 FLD1_55_D02.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165798.1|CO165798 FLD1_57_D12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO165835.1|CO165835 FLD1_57_H12.b1_A029 Root flooded Pin... 54 1e-005
gb|CO165896.1|CO165896 FLD1_57_H12.g1_A029 Root flooded Pin... 54 1e-005
gb|CO165945.1|CO165945 FLD1_58_F04.b1_A029 Root flooded Pin... 54 1e-005
gb|CO166022.1|CO166022 FLD1_58_F04.g1_A029 Root flooded Pin... 54 1e-005
gb|CO166763.1|CO166763 FLD1_64_G08.b1_A029 Root flooded Pin... 54 1e-005
gb|CO166973.1|CO166973 FLD1_65_G10.g1_A029 Root flooded Pin... 54 1e-005
gb|CO167032.1|CO167032 FLD1_66_G08.b1_A029 Root flooded Pin... 54 1e-005
gb|CO167469.1|CO167469 FLD1_69_D07.b1_A029 Root flooded Pin... 54 1e-005
gb|CO167479.1|CO167479 FLD1_69_E07.b1_A029 Root flooded Pin... 54 1e-005
gb|CO196749.1|CO196749 GEO1_1_G04.b1_A029 Root gravitropism... 54 1e-005
gb|CO197099.1|CO197099 GEO1_3_H05.g1_A029 Root gravitropism... 54 1e-005
gb|CO197959.1|CO197959 GEO1_10_G10.b1_A029 Root gravitropis... 54 1e-005
gb|CO198058.1|CO198058 GEO1_11_A10.b1_A029 Root gravitropis... 54 1e-005
gb|CO198491.1|CO198491 GEO1_14_C03.b1_A029 Root gravitropis... 54 1e-005
gb|CO199080.1|CO199080 GEO1_18_E02.g1_A029 Root gravitropis... 54 1e-005
gb|CO200763.1|CO200763 RTCNT2_1_H04.b1_A029 Root control 2 ... 54 1e-005
gb|CO362387.1|CO362387 RTK1_3_F01.b1_A029 Roots minus potas... 54 1e-005
gb|CO362874.1|CO362874 RTK1_6_F12.b1_A029 Roots minus potas... 54 1e-005
gb|CO364030.1|CO364030 RTK1_13_F09.b1_A029 Roots minus pota... 54 1e-005
gb|CO364191.1|CO364191 RTK1_14_F05.b1_A029 Roots minus pota... 54 1e-005
gb|CO364274.1|CO364274 RTK1_14_F05.g1_A029 Roots minus pota... 54 1e-005
gb|CO368546.1|CO368546 RTK1_41_G04.b1_A029 Roots minus pota... 54 1e-005
gb|CO368601.1|CO368601 RTK1_41_D08.g1_A029 Roots minus pota... 54 1e-005
gb|CO368630.1|CO368630 RTK1_41_G04.g1_A029 Roots minus pota... 54 1e-005
gb|CO368843.1|CO368843 RTK1_43_E08.b1_A029 Roots minus pota... 54 1e-005
gb|CV031443.1|CV031443 RTNACL1_1_D04.g1_A029 Roots plus add... 54 1e-005
gb|CV033097.1|CV033097 RTNACL1_20_F09.b1_A029 Roots plus ad... 54 1e-005
gb|CV034196.1|CV034196 RTNACL1_39_G07.b1_A029 Roots plus ad... 54 1e-005
gb|CV034391.1|CV034391 RTNACL1_40_D06.g1_A029 Roots plus ad... 54 1e-005
gb|CV034400.1|CV034400 RTNACL1_40_E03.g1_A029 Roots plus ad... 54 1e-005
gb|CV035170.1|CV035170 RTNACL1_14_E02.b1_A029 Roots plus ad... 54 1e-005
gb|CV035986.1|CV035986 RTNACL1_43_G10.g1_A029 Roots plus ad... 54 1e-005
gb|CV036483.1|CV036483 RTNACL1_59_C08.g1_A029 Roots plus ad... 54 1e-005
gb|CX646108.1|CX646108 COLD1_7_H02.b1_A029 Root cold Pinus ... 54 1e-005
gb|CX648881.1|CX648881 COLD1_31_B09.g1_A029 Root cold Pinus... 54 1e-005
gb|CX649979.1|CX649979 COLD1_42_E12.g1_A029 Root cold Pinus... 54 1e-005
gb|CX653060.1|CX653060 COLD1_63_D11.b1_A029 Root cold Pinus... 54 1e-005
gb|DN609212.1|DN609212 EST962262 Subtracted pine embryo lib... 54 1e-005
gb|DN609509.1|DN609509 EST962559 Subtracted pine embryo lib... 54 1e-005
gb|DN626702.1|DN626702 EST977518 Subtracted pine embryo lib... 54 1e-005
gb|DN627195.1|DN627195 EST978011 Subtracted pine embryo lib... 54 1e-005
gb|DN627373.1|DN627373 EST978189 Subtracted pine embryo lib... 54 1e-005
gb|DN627384.1|DN627384 EST978200 Subtracted pine embryo lib... 54 1e-005
gb|DN627604.1|DN627604 EST978420 Subtracted pine embryo lib... 54 1e-005
gb|DN627700.1|DN627700 EST978516 Subtracted pine embryo lib... 54 1e-005
gb|DN628743.1|DN628743 EST979559 Subtracted pine embryo lib... 54 1e-005
gb|DN629926.1|DN629926 EST980742 Subtracted pine embryo lib... 54 1e-005
gb|DN629961.1|DN629961 EST980777 Subtracted pine embryo lib... 54 1e-005
gb|DN630599.1|DN630599 EST981415 Subtracted pine embryo lib... 54 1e-005
gb|DN630655.1|DN630655 EST981471 Subtracted pine embryo lib... 54 1e-005
gb|DN631389.1|DN631389 EST982205 Subtracted pine embryo lib... 54 1e-005
gb|DN631396.1|DN631396 EST982212 Subtracted pine embryo lib... 54 1e-005
gb|DN631965.1|DN631965 EST982781 Subtracted pine embryo lib... 54 1e-005
gb|DN633221.1|DN633221 EST984037 Subtracted pine embryo lib... 54 1e-005
gb|DN633227.1|DN633227 EST984043 Subtracted pine embryo lib... 54 1e-005
gb|DN634053.1|DN634053 EST984869 Subtracted pine embryo lib... 54 1e-005
gb|DN634056.1|DN634056 EST984872 Subtracted pine embryo lib... 54 1e-005
gb|DN634080.1|DN634080 EST984896 Subtracted pine embryo lib... 54 1e-005
gb|DN634383.1|DN634383 EST985199 Subtracted pine embryo lib... 54 1e-005
gb|DR011570.1|DR011570 HEAT1_6_C01.g1_A029 Root at 37 C for... 54 1e-005
gb|DR012458.1|DR012458 HEAT1_13_B01.b1_A029 Root at 37 C fo... 54 1e-005
gb|DR012832.1|DR012832 HEAT1_15_F11.b1_A029 Root at 37 C fo... 54 1e-005
gb|DR014647.1|DR014647 HEAT1_50_F05.g1_A029 Root at 37 C fo... 54 1e-005
gb|DR015082.1|DR015082 STRS1_1_H12.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR015175.1|DR015175 STRS1_1_H12.g1_A034 Shoot tip pitch ... 54 1e-005
gb|DR015194.1|DR015194 STRS1_2_B09.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR015270.1|DR015270 STRS1_2_B06.g1_A034 Shoot tip pitch ... 54 1e-005
gb|DR015534.1|DR015534 STRS1_4_C10.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR015857.1|DR015857 STRS1_6_C12.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR016016.1|DR016016 STRS1_7_D04.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR016057.1|DR016057 STRS1_7_H12.b1_A034 Shoot tip pitch ... 54 1e-005
gb|DR016710.1|DR016710 STRS1_11_E09.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR016744.1|DR016744 STRS1_11_H11.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR016753.1|DR016753 STRS1_12_A08.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR016830.1|DR016830 STRS1_12_A08.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR016972.1|DR016972 STRS1_13_F10.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR017154.1|DR017154 STRS1_14_H10.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR017588.1|DR017588 STRS1_17_F06.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR017733.1|DR017733 STRS1_18_D07.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR018445.1|DR018445 STRS1_23_B12.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR018697.1|DR018697 STRS1_25_C12.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR019373.1|DR019373 STRS1_29_D01.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR020189.1|DR020189 STRS1_35_F02.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR020265.1|DR020265 STRS1_35_F02.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR020763.1|DR020763 STRS1_39_D07.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR021266.1|DR021266 STRS1_43_B02.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR021369.1|DR021369 STRS1_44_E07.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR021517.1|DR021517 STRS1_45_E06.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR022268.1|DR022268 STRS1_50_A01.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR022580.1|DR022580 STRS1_52_B11.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR022629.1|DR022629 STRS1_52_H06.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR022917.1|DR022917 STRS1_54_G12.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR023685.1|DR023685 STRS1_59_H03.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR023836.1|DR023836 STRS1_60_H06.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR024278.1|DR024278 STRS1_63_F07.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR024359.1|DR024359 STRS1_64_A11.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR024484.1|DR024484 STRS1_65_G01.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR024557.1|DR024557 STRS1_65_G01.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR047626.1|DR047626 RTBOR1_2_G07.b1_A029 Roots plus adde... 54 1e-005
gb|DR047855.1|DR047855 RTBOR1_5_C12.b2_A029 Roots plus adde... 54 1e-005
gb|DR047933.1|DR047933 RTBOR1_5_C12.g2_A029 Roots plus adde... 54 1e-005
gb|DR048923.1|DR048923 RTBOR1_12_D02.b1_A029 Roots plus add... 54 1e-005
gb|DR049338.1|DR049338 RTBOR1_15_C12.g1_A029 Roots plus add... 54 1e-005
gb|DR050358.1|DR050358 RTBOR1_23_A04.b1_A029 Roots plus add... 54 1e-005
gb|DR050428.1|DR050428 RTBOR1_23_A04.g1_A029 Roots plus add... 54 1e-005
gb|DR050874.1|DR050874 RTBOR1_26_E12.b1_A029 Roots plus add... 54 1e-005
gb|DR051188.1|DR051188 RTBOR1_28_F05.b1_A029 Roots plus add... 54 1e-005
gb|DR051462.1|DR051462 RTBOR1_30_F03.b1_A029 Roots plus add... 54 1e-005
gb|DR055656.1|DR055656 RTCA1_25_C03.b1_A029 Roots minus cal... 54 1e-005
gb|DR059137.1|DR059137 RTNIT1_15_H10.g1_A029 Roots minus ni... 54 1e-005
gb|DR069154.1|DR069154 RTDK1_5_F03.b1_A029 Roots, dark Pinu... 54 1e-005
gb|DR069461.1|DR069461 RTDK1_7_H11.b1_A029 Roots, dark Pinu... 54 1e-005
gb|DR069551.1|DR069551 RTDK1_7_H11.g1_A029 Roots, dark Pinu... 54 1e-005
gb|DR069593.1|DR069593 RTDK1_8_E08.b1_A029 Roots, dark Pinu... 54 1e-005
gb|DR069674.1|DR069674 RTDK1_8_E12.g1_A029 Roots, dark Pinu... 54 1e-005
gb|DR071605.1|DR071605 RTDK1_21_A07.b1_A029 Roots, dark Pin... 54 1e-005
gb|DR072199.1|DR072199 RTDK1_24_E09.g1_A029 Roots, dark Pin... 54 1e-005
gb|DR072333.1|DR072333 RTDK1_25_C09.g1_A029 Roots, dark Pin... 54 1e-005
gb|DR072624.1|DR072624 RTDK1_27_B09.g1_A029 Roots, dark Pin... 54 1e-005
gb|DR079958.1|DR079958 RTFEPL1_19_B07.b1_A029 Roots plus ad... 54 1e-005
gb|DR088362.1|DR088362 RTAL1_1_E02.b1_A029 Roots plus added... 54 1e-005
gb|DR089563.1|DR089563 RTAL1_9_B02.g1_A029 Roots plus added... 54 1e-005
gb|DR089969.1|DR089969 RTAL1_12_A04.b1_A029 Roots plus adde... 54 1e-005
gb|DR090039.1|DR090039 RTAL1_12_H01.b1_A029 Roots plus adde... 54 1e-005
gb|DR090721.1|DR090721 RTAL1_17_A09.b1_A029 Roots plus adde... 54 1e-005
gb|DR090773.1|DR090773 RTAL1_17_F09.b1_A029 Roots plus adde... 54 1e-005
gb|DR091648.1|DR091648 RTAL1_23_B08.b1_A029 Roots plus adde... 54 1e-005
gb|DR091821.1|DR091821 RTAL1_24_E01.b1_A029 Roots plus adde... 54 1e-005
gb|DR092385.1|DR092385 STRR1_1_C06.b1_A033 Stem Response Re... 54 1e-005
gb|DR092651.1|DR092651 STRR1_2_F11.g1_A033 Stem Response Re... 54 1e-005
gb|DR092674.1|DR092674 STRR1_3_A06.b1_A033 Stem Response Re... 54 1e-005
gb|DR092724.1|DR092724 STRR1_3_A06.g1_A033 Stem Response Re... 54 1e-005
gb|DR092951.1|DR092951 STRR1_5_C12.b1_A033 Stem Response Re... 54 1e-005
gb|DR092983.1|DR092983 STRR1_5_G03.b1_A033 Stem Response Re... 54 1e-005
gb|DR093065.1|DR093065 STRR1_5_G03.g1_A033 Stem Response Re... 54 1e-005
gb|DR093135.1|DR093135 STRR1_6_G01.b1_A033 Stem Response Re... 54 1e-005
gb|DR093138.1|DR093138 STRR1_6_G06.b1_A033 Stem Response Re... 54 1e-005
gb|DR093144.1|DR093144 STRR1_6_H01.b1_A033 Stem Response Re... 54 1e-005
gb|DR093213.1|DR093213 STRR1_6_G01.g1_A033 Stem Response Re... 54 1e-005
gb|DR093216.1|DR093216 STRR1_6_G06.g1_A033 Stem Response Re... 54 1e-005
gb|DR093295.1|DR093295 STRR1_7_H05.b1_A033 Stem Response Re... 54 1e-005
gb|DR093379.1|DR093379 STRR1_7_H05.g1_A033 Stem Response Re... 54 1e-005
gb|DR093851.1|DR093851 STRR1_10_G01.g1_A033 Stem Response R... 54 1e-005
gb|DR094283.1|DR094283 STRR1_13_D01.g1_A033 Stem Response R... 54 1e-005
gb|DR094350.1|DR094350 STRR1_14_B04.b1_A033 Stem Response R... 54 1e-005
gb|DR094352.1|DR094352 STRR1_14_B06.b1_A033 Stem Response R... 54 1e-005
gb|DR094423.1|DR094423 STRR1_14_B04.g1_A033 Stem Response R... 54 1e-005
gb|DR094424.1|DR094424 STRR1_14_B06.g1_A033 Stem Response R... 54 1e-005
gb|DR094716.1|DR094716 STRR1_16_G03.b1_A033 Stem Response R... 54 1e-005
gb|DR095020.1|DR095020 STRR1_18_F10.b1_A033 Stem Response R... 54 1e-005
gb|DR095191.1|DR095191 STRR1_19_H12.b1_A033 Stem Response R... 54 1e-005
gb|DR095208.1|DR095208 STRR1_19_B08.g1_A033 Stem Response R... 54 1e-005
gb|DR095418.1|DR095418 STRR1_20_H05.g1_A033 Stem Response R... 54 1e-005
gb|DR095948.1|DR095948 STRR1_24_E10.g1_A033 Stem Response R... 54 1e-005
gb|DR096608.1|DR096608 STRR1_29_B09.b1_A033 Stem Response R... 54 1e-005
gb|DR096654.1|DR096654 STRR1_29_H02.b1_A033 Stem Response R... 54 1e-005
gb|DR096692.1|DR096692 STRR1_29_D01.g1_A033 Stem Response R... 54 1e-005
gb|DR096725.1|DR096725 STRR1_29_H02.g1_A033 Stem Response R... 54 1e-005
gb|DR096742.1|DR096742 STRR1_30_B08.b1_A033 Stem Response R... 54 1e-005
gb|DR096796.1|DR096796 STRR1_30_A04.g1_A033 Stem Response R... 54 1e-005
gb|DR096915.1|DR096915 STRR1_31_F03.b1_A033 Stem Response R... 54 1e-005
gb|DR097046.1|DR097046 STRR1_32_D08.b1_A033 Stem Response R... 54 1e-005
gb|DR097290.1|DR097290 STRR1_33_F02.g3_A033 Stem Response R... 54 1e-005
gb|DR097408.1|DR097408 STRR1_34_B04.g3_A033 Stem Response R... 54 1e-005
gb|DR097506.1|DR097506 STRR1_35_C08.b1_A033 Stem Response R... 54 1e-005
gb|DR097783.1|DR097783 STRR1_37_A10.b1_A033 Stem Response R... 54 1e-005
gb|DR098098.1|DR098098 STRR1_39_C09.b1_A033 Stem Response R... 54 1e-005
gb|DR098193.1|DR098193 STRR1_39_E09.g1_A033 Stem Response R... 54 1e-005
gb|DR098845.1|DR098845 STRR1_48_F05.b1_A033 Stem Response R... 54 1e-005
gb|DR099931.1|DR099931 STRR1_60_D07.b1_A033 Stem Response R... 54 1e-005
gb|DR099985.1|DR099985 STRR1_60_D10.g1_A033 Stem Response R... 54 1e-005
gb|DR100053.1|DR100053 STRR1_61_F05.b1_A033 Stem Response R... 54 1e-005
gb|DR100541.1|DR100541 STRR1_65_A06.b1_A033 Stem Response R... 54 1e-005
gb|DR100760.1|DR100760 STRR1_67_F11.g1_A033 Stem Response R... 54 1e-005
gb|DR100889.1|DR100889 STRR1_69_C03.b1_A033 Stem Response R... 54 1e-005
gb|DR100959.1|DR100959 STRR1_69_C03.g1_A033 Stem Response R... 54 1e-005
gb|DR101035.1|DR101035 STRR1_70_C10.b1_A033 Stem Response R... 54 1e-005
gb|DR101072.1|DR101072 STRR1_70_H02.b1_A033 Stem Response R... 54 1e-005
gb|DR101168.1|DR101168 STRR1_71_B09.b1_A033 Stem Response R... 54 1e-005
gb|DR101314.1|DR101314 STRR1_72_B08.b1_A033 Stem Response R... 54 1e-005
gb|DR101331.1|DR101331 STRR1_72_D11.b1_A033 Stem Response R... 54 1e-005
gb|DR101558.1|DR101558 STRR1_74_D12.b1_A033 Stem Response R... 54 1e-005
gb|DR101624.1|DR101624 STRR1_74_D07.g1_A033 Stem Response R... 54 1e-005
gb|DR101805.1|DR101805 STRR1_76_A09.b1_A033 Stem Response R... 54 1e-005
gb|DR101830.1|DR101830 STRR1_76_D09.b1_A033 Stem Response R... 54 1e-005
gb|DR102360.1|DR102360 STRR1_80_C03.g1_A033 Stem Response R... 54 1e-005
gb|DR102434.1|DR102434 STRR1_81_C09.b1_A033 Stem Response R... 54 1e-005
gb|DR109603.1|DR109603 RTS1_3_H11.b1_A029 Roots minus sulfu... 54 1e-005
gb|DR110190.1|DR110190 RTS1_9_A09.g1_A029 Roots minus sulfu... 54 1e-005
gb|DR110448.1|DR110448 RTS1_11_A04.b1_A029 Roots minus sulf... 54 1e-005
gb|DR110532.1|DR110532 RTS1_11_A04.g1_A029 Roots minus sulf... 54 1e-005
gb|DR117318.1|DR117318 RTMG1_6_F06.b1_A029 Roots minus magn... 54 1e-005
gb|DR118791.1|DR118791 RTMG1_19_E11.b1_A029 Roots minus mag... 54 1e-005
gb|DR118873.1|DR118873 RTMG1_19_E11.g1_A029 Roots minus mag... 54 1e-005
gb|DR119919.1|DR119919 RTMG1_26_H08.b1_A029 Roots minus mag... 54 1e-005
gb|DR166458.1|DR166458 RTPHOS1_12_D01.b2_A029 Roots minus p... 54 1e-005
gb|DR167086.1|DR167086 RTPHOS1_16_C10.g1_A029 Roots minus p... 54 1e-005
gb|DR168680.1|DR168680 RTPHOS1_27_D08.b1_A029 Roots minus p... 54 1e-005
gb|DR168757.1|DR168757 RTPHOS1_27_D08.g1_A029 Roots minus p... 54 1e-005
gb|DR179491.1|DR179491 RTMNUT1_22_A09.g2_A029 Roots minus m... 54 1e-005
gb|DR180650.1|DR180650 RTMNUT1_34_A10.b1_A029 Roots minus m... 54 1e-005
gb|DR384457.1|DR384457 RTHG1_2_H04.b1_A029 Roots plus added... 54 1e-005
gb|DR384539.1|DR384539 RTHG1_2_H04.g1_A029 Roots plus added... 54 1e-005
gb|DR384554.1|DR384554 RTHG1_3_B06.b1_A029 Roots plus added... 54 1e-005
gb|DR384574.1|DR384574 RTHG1_3_D07.b1_A029 Roots plus added... 54 1e-005
gb|DR384602.1|DR384602 RTHG1_3_G06.b1_A029 Roots plus added... 54 1e-005
gb|DR384722.1|DR384722 RTHG1_4_D06.b1_A029 Roots plus added... 54 1e-005
gb|DR385171.1|DR385171 RTHG1_7_C01.b1_A029 Roots plus added... 54 1e-005
gb|DR385416.1|DR385416 RTHG1_8_B12.g1_A029 Roots plus added... 54 1e-005
gb|DR385539.1|DR385539 RTHG1_9_F12.b1_A029 Roots plus added... 54 1e-005
gb|DR385580.1|DR385580 RTHG1_9_C01.g1_A029 Roots plus added... 54 1e-005
gb|DR386347.1|DR386347 RTHG1_14_C02.g1_A029 Roots plus adde... 54 1e-005
gb|DR387032.1|DR387032 RTHG1_19_A07.b1_A029 Roots plus adde... 54 1e-005
gb|DR387099.1|DR387099 RTHG1_19_A07.g1_A029 Roots plus adde... 54 1e-005
gb|DR387187.1|DR387187 RTHG1_20_C05.b1_A029 Roots plus adde... 54 1e-005
gb|DR387193.1|DR387193 RTHG1_20_D01.b1_A029 Roots plus adde... 54 1e-005
gb|DR387265.1|DR387265 RTHG1_20_D01.g1_A029 Roots plus adde... 54 1e-005
gb|DR387581.1|DR387581 RTHG1_22_F12.g2_A029 Roots plus adde... 54 1e-005
gb|DR387648.1|DR387648 RTHG1_23_E12.b1_A029 Roots plus adde... 54 1e-005
gb|DR387815.1|DR387815 RTHG1_24_G09.b1_A029 Roots plus adde... 54 1e-005
gb|DR388318.1|DR388318 RTHG1_27_B06.g1_A029 Roots plus adde... 54 1e-005
gb|DR388362.1|DR388362 RTHG1_27_F08.g1_A029 Roots plus adde... 54 1e-005
gb|DR388890.1|DR388890 RTHG1_31_C12.b1_A029 Roots plus adde... 54 1e-005
gb|DR388949.1|DR388949 RTHG1_31_B01.g1_A029 Roots plus adde... 54 1e-005
gb|DR388967.1|DR388967 RTHG1_31_C12.g1_A029 Roots plus adde... 54 1e-005
gb|DR692592.1|DR692592 EST1082680 Normalized pine embryo li... 54 1e-005
gb|DR746314.1|DR746314 RTCU1_36_E01.b1_A029 Roots plus adde... 54 1e-005
gb|DR746391.1|DR746391 RTCU1_36_E01.g1_A029 Roots plus adde... 54 1e-005
gb|AF457092.1| Pinus elliottii var. elliottii Pechi1 putati... 54 1e-005
gb|AF457093.1| Pinus elliottii var. elliottii Pechi191 puta... 54 1e-005
gb|BF778111.1|BF778111 NXSI_077_C06_F NXSI (Nsf Xylem Side ... 52 5e-005
gb|DN627763.1|DN627763 EST978579 Subtracted pine embryo lib... 52 5e-005
gb|DN629136.1|DN629136 EST979952 Subtracted pine embryo lib... 52 5e-005
gb|DN633674.1|DN633674 EST984490 Subtracted pine embryo lib... 52 5e-005
gb|DR095100.1|DR095100 STRR1_18_F10.g1_A033 Stem Response R... 50 2e-004
gb|DR098471.1|DR098471 STRR1_45_F01.g1_A033 Stem Response R... 50 2e-004
gb|DR100067.1|DR100067 STRR1_61_H04.b1_A033 Stem Response R... 50 2e-004
gb|DR688508.1|DR688508 EST1078592 Normalized pine embryo li... 50 2e-004
gb|AY705804.1| Pinus halepensis clone 27r chitinase-like mR... 50 2e-004
gb|BM133734.1|BM133734 NXLV_011_E04_F NXLV (Nsf Xylem Late ... 48 8e-004
gb|CF386384.1|CF386384 RTDR1_14_F07.b1_A015 Loblolly pine r... 48 8e-004
gb|CF387786.1|CF387786 RTDR1_18_H04.b1_A015 Loblolly pine r... 48 8e-004
gb|CF388211.1|CF388211 RTDR2_1_H11.g1_A021 Loblolly pine ro... 48 8e-004
gb|CF395470.1|CF395470 RTDS2_11_D06.g1_A021 Drought-stresse... 48 8e-004
gb|CF396431.1|CF396431 RTDS2_22_E06.b1_A021 Drought-stresse... 48 8e-004
gb|CF397664.1|CF397664 RTDS3_1_A06.b2_A022 Drought-stressed... 48 8e-004
gb|CF398048.1|CF398048 RTDS3_22_E10.b1_A022 Drought-stresse... 48 8e-004
gb|CO158832.1|CO158832 FLD1_9_C03.g1_A029 Root flooded Pinu... 48 8e-004
gb|CO160085.1|CO160085 FLD1_18_F09.b1_A029 Root flooded Pin... 48 8e-004
gb|CO163220.1|CO163220 FLD1_40_F01.b1_A029 Root flooded Pin... 48 8e-004
gb|CO163303.1|CO163303 FLD1_40_F01.g1_A029 Root flooded Pin... 48 8e-004
gb|CO165672.1|CO165672 FLD1_56_E07.b1_A029 Root flooded Pin... 48 8e-004
gb|CO166901.1|CO166901 FLD1_65_H02.b1_A029 Root flooded Pin... 48 8e-004
gb|CO167560.1|CO167560 FLD1_69_E07.g1_A029 Root flooded Pin... 48 8e-004
gb|CO196827.1|CO196827 GEO1_1_G04.g1_A029 Root gravitropism... 48 8e-004
gb|CO198038.1|CO198038 GEO1_10_G10.g1_A029 Root gravitropis... 48 8e-004
gb|DN445887.1|DN445887 EST941686 Sequencing ESTs from loblo... 48 8e-004
gb|DN457728.1|DN457728 EST953527 Sequencing ESTs from loblo... 48 8e-004
gb|DN463085.1|DN463085 EST958884 Sequencing ESTs from loblo... 48 8e-004
gb|DN630855.1|DN630855 EST981671 Subtracted pine embryo lib... 48 8e-004
gb|DR015614.1|DR015614 STRS1_4_C10.g1_A034 Shoot tip pitch ... 48 8e-004
gb|DR015885.1|DR015885 STRS1_6_G01.b1_A034 Shoot tip pitch ... 48 8e-004
gb|DR015964.1|DR015964 STRS1_6_G01.g1_A034 Shoot tip pitch ... 48 8e-004
gb|DR016654.1|DR016654 STRS1_11_H11.b1_A034 Shoot tip pitch... 48 8e-004
gb|DR017232.1|DR017232 STRS1_14_H10.g1_A034 Shoot tip pitch... 48 8e-004
gb|DR017790.1|DR017790 STRS1_18_B08.g1_A034 Shoot tip pitch... 48 8e-004
gb|DR018449.1|DR018449 STRS1_23_C05.b1_A034 Shoot tip pitch... 48 8e-004
gb|DR018508.1|DR018508 STRS1_23_B12.g1_A034 Shoot tip pitch... 48 8e-004
gb|DR020844.1|DR020844 STRS1_39_D07.g1_A034 Shoot tip pitch... 48 8e-004
gb|DR022702.1|DR022702 STRS1_52_H06.g1_A034 Shoot tip pitch... 48 8e-004
gb|DR025499.1|DR025499 STRS1_72_B01.b1_A034 Shoot tip pitch... 48 8e-004
gb|DR055730.1|DR055730 RTCA1_25_C03.g1_A029 Roots minus cal... 48 8e-004
gb|DR056166.1|DR056166 RTCA1_28_B03.g1_A029 Roots minus cal... 48 8e-004
gb|DR094138.1|DR094138 STRR1_12_E04.g1_A033 Stem Response R... 48 8e-004
gb|DR097848.1|DR097848 STRR1_37_A10.g1_A033 Stem Response R... 48 8e-004
gb|DR097950.1|DR097950 STRR1_38_D03.b1_A033 Stem Response R... 48 8e-004
gb|DR098018.1|DR098018 STRR1_38_D03.g1_A033 Stem Response R... 48 8e-004
gb|DR098533.1|DR098533 STRR1_46_D11.b1_A033 Stem Response R... 48 8e-004
gb|DR120001.1|DR120001 RTMG1_26_H08.g2_A029 Roots minus mag... 48 8e-004
gb|CF391842.1|CF391842 RTDR3_10_B11.b1_A022 Loblolly pine r... 46 0.003
gb|CF392844.1|CF392844 RTDR3_19_A02.g1_A022 Loblolly pine r... 46 0.003
gb|CF397691.1|CF397691 RTDS3_1_A01.b2_A022 Drought-stressed... 46 0.003
gb|CF470438.1|CF470438 RTDS1_17_H03.g1_A015 Drought-stresse... 46 0.003
gb|CF470865.1|CF470865 RTDS1_15_F04.b1_A015 Drought-stresse... 46 0.003
gb|CF470916.1|CF470916 RTDS1_15_F04.g1_A015 Drought-stresse... 46 0.003
gb|CF471728.1|CF471728 RTDS1_6_A03.b1_A015 Drought-stressed... 46 0.003
gb|CF471984.1|CF471984 RTDS1_7_F08.g1_A015 Drought-stressed... 46 0.003
gb|CF472390.1|CF472390 RTDS1_9_G12.g1_A015 Drought-stressed... 46 0.003
gb|CF665503.1|CF665503 RTCNT1_16_H12.b1_A029 Root control P... 46 0.003
gb|CF665579.1|CF665579 RTCNT1_16_H12.g1_A029 Root control P... 46 0.003
gb|CF665639.1|CF665639 RTCNT1_17_F09.b1_A029 Root control P... 46 0.003
gb|CF667816.1|CF667816 RTCNT1_32_E06.g1_A029 Root control P... 46 0.003
gb|CF670863.1|CF670863 RTCNT1_53_C09.b1_A029 Root control P... 46 0.003
gb|CF670936.1|CF670936 RTCNT1_53_C09.g1_A029 Root control P... 46 0.003
gb|CF671101.1|CF671101 RTCNT1_54_E11.g1_A029 Root control P... 46 0.003
gb|CF672127.1|CF672127 RTCNT1_61_C03.g1_A029 Root control P... 46 0.003
gb|BX679188.1|BX679188 BX679188 RS Pinus pinaster cDNA clon... 46 0.003
gb|CO159298.1|CO159298 FLD1_12_E09.g1_A029 Root flooded Pin... 46 0.003
gb|CO160130.1|CO160130 FLD1_19_A05.b1_A029 Root flooded Pin... 46 0.003
gb|CO160203.1|CO160203 FLD1_19_A05.g1_A029 Root flooded Pin... 46 0.003
gb|CO160513.1|CO160513 FLD1_21_B12.g1_A029 Root flooded Pin... 46 0.003
gb|CO161579.1|CO161579 FLD1_29_G02.g1_A029 Root flooded Pin... 46 0.003
gb|CO161755.1|CO161755 FLD1_31_A05.b1_A029 Root flooded Pin... 46 0.003
gb|CO162290.1|CO162290 FLD1_34_H08.b1_A029 Root flooded Pin... 46 0.003
gb|CO162374.1|CO162374 FLD1_34_H08.g1_A029 Root flooded Pin... 46 0.003
gb|CO162463.1|CO162463 FLD1_35_A09.g1_A029 Root flooded Pin... 46 0.003
gb|CO162468.1|CO162468 FLD1_35_B02.g1_A029 Root flooded Pin... 46 0.003
gb|CO164896.1|CO164896 FLD1_51_B04.b1_A029 Root flooded Pin... 46 0.003
gb|CO164972.1|CO164972 FLD1_51_B04.g1_A029 Root flooded Pin... 46 0.003
gb|CO166349.1|CO166349 FLD1_61_G07.b1_A029 Root flooded Pin... 46 0.003
gb|CO166415.1|CO166415 FLD1_61_G07.g1_A029 Root flooded Pin... 46 0.003
gb|CO167643.1|CO167643 FLD1_70_F02.b1_A029 Root flooded Pin... 46 0.003
gb|CO167766.1|CO167766 FLD1_71_B08.b1_A029 Root flooded Pin... 46 0.003
gb|CO167929.1|CO167929 FLD1_72_E05.b1_A029 Root flooded Pin... 46 0.003
gb|CO168011.1|CO168011 FLD1_72_E05.g1_A029 Root flooded Pin... 46 0.003
gb|CO197688.1|CO197688 GEO1_8_G03.b1_A029 Root gravitropism... 46 0.003
gb|CO198551.1|CO198551 GEO1_14_B12.g1_A029 Root gravitropis... 46 0.003
gb|CO198871.1|CO198871 GEO1_17_E04.b1_A029 Root gravitropis... 46 0.003
gb|CO368988.1|CO368988 RTK1_44_E07.b1_A029 Roots minus pota... 46 0.003
gb|CV032043.1|CV032043 RTNACL1_5_H06.b1_A029 Roots plus add... 46 0.003
gb|CV033933.1|CV033933 RTNACL1_37_B07.g1_A029 Roots plus ad... 46 0.003
gb|CV035397.1|CV035397 RTNACL1_15_G01.g1_A029 Roots plus ad... 46 0.003
gb|CV035407.1|CV035407 RTNACL1_15_H01.g1_A029 Roots plus ad... 46 0.003
gb|CV036323.1|CV036323 RTNACL1_58_H12.b1_A029 Roots plus ad... 46 0.003
gb|CV036557.1|CV036557 RTNACL1_60_C09.b1_A029 Roots plus ad... 46 0.003
gb|CV136511.1|CV136511 EST847720 Sequencing ESTs from loblo... 46 0.003
gb|CX648684.1|CX648684 COLD1_30_F03.b1_A029 Root cold Pinus... 46 0.003
gb|CX713823.1|CX713823 RTPQ1_13_D02.g1_A032 Roots treated w... 46 0.003
gb|CX715093.1|CX715093 RTPQ1_31_D09.b1_A032 Roots treated w... 46 0.003
gb|CX715134.1|CX715134 RTPQ1_31_D09.g1_A032 Roots treated w... 46 0.003
gb|DN450568.1|DN450568 EST946367 Sequencing ESTs from loblo... 46 0.003
gb|DN459511.1|DN459511 EST955310 Sequencing ESTs from loblo... 46 0.003
gb|DN464308.1|DN464308 EST960107 Sequencing ESTs from loblo... 46 0.003
gb|DR010833.1|DR010833 HEAT1_1_D01.g1_A029 Root at 37 C for... 46 0.003
gb|DR011184.1|DR011184 HEAT1_4_C10.b1_A029 Root at 37 C for... 46 0.003
gb|DR011226.1|DR011226 HEAT1_4_H01.b1_A029 Root at 37 C for... 46 0.003
gb|DR011256.1|DR011256 HEAT1_4_C10.g1_A029 Root at 37 C for... 46 0.003
gb|DR012513.1|DR012513 HEAT1_13_G10.b1_A029 Root at 37 C fo... 46 0.003
gb|DR012593.1|DR012593 HEAT1_13_G10.g1_A029 Root at 37 C fo... 46 0.003
gb|DR013746.1|DR013746 HEAT1_21_F06.b1_A029 Root at 37 C fo... 46 0.003
gb|DR013826.1|DR013826 HEAT1_21_F06.g1_A029 Root at 37 C fo... 46 0.003
gb|DR014076.1|DR014076 HEAT1_23_F04.b1_A029 Root at 37 C fo... 46 0.003
gb|DR015714.1|DR015714 STRS1_5_E05.b1_A034 Shoot tip pitch ... 46 0.003
gb|DR015796.1|DR015796 STRS1_5_E05.g1_A034 Shoot tip pitch ... 46 0.003
gb|DR016280.1|DR016280 STRS1_9_D12.b1_A034 Shoot tip pitch ... 46 0.003
gb|DR018110.1|DR018110 STRS1_20_C02.g1_A034 Shoot tip pitch... 46 0.003
gb|DR019767.1|DR019767 STRS1_32_F12.b1_A034 Shoot tip pitch... 46 0.003
gb|DR019844.1|DR019844 STRS1_32_F12.g1_A034 Shoot tip pitch... 46 0.003
gb|DR021193.1|DR021193 STRS1_43_B03.b1_A034 Shoot tip pitch... 46 0.003
gb|DR021267.1|DR021267 STRS1_43_B03.g1_A034 Shoot tip pitch... 46 0.003
gb|DR021628.1|DR021628 STRS1_46_A01.b1_A034 Shoot tip pitch... 46 0.003
gb|DR022290.1|DR022290 STRS1_50_C06.b1_A034 Shoot tip pitch... 46 0.003
gb|DR022470.1|DR022470 STRS1_51_F12.b1_A034 Shoot tip pitch... 46 0.003
gb|DR022620.1|DR022620 STRS1_52_G02.b1_A034 Shoot tip pitch... 46 0.003
gb|DR022759.1|DR022759 STRS1_53_G01.b1_A034 Shoot tip pitch... 46 0.003
gb|DR023505.1|DR023505 STRS1_58_D03.b1_A034 Shoot tip pitch... 46 0.003
gb|DR023582.1|DR023582 STRS1_58_E02.g1_A034 Shoot tip pitch... 46 0.003
gb|DR023704.1|DR023704 STRS1_59_B02.g1_A034 Shoot tip pitch... 46 0.003
gb|DR024082.1|DR024082 STRS1_62_D09.b1_A034 Shoot tip pitch... 46 0.003
gb|DR024298.1|DR024298 STRS1_63_H08.g1_A034 Shoot tip pitch... 46 0.003
gb|DR024374.1|DR024374 STRS1_64_C05.g1_A034 Shoot tip pitch... 46 0.003
gb|DR024903.1|DR024903 STRS1_68_G02.b1_A034 Shoot tip pitch... 46 0.003
gb|DR024985.1|DR024985 STRS1_68_G02.g1_A034 Shoot tip pitch... 46 0.003
>gb|U57410.1|PSU57410 Pinus strobus chitinase (Pschi4) gene, complete cds
Length = 2092
Score = 69.9 bits (35), Expect = 2e-010
Identities = 80/95 (84%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaaccagacggcggtctcg 430
|||||||||||||| ||||| || ||||||| ||||||||||||||| || || ||||
Sbjct: 1530 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaaccaaaccgccgtctta 1471
Query: 431 aacgacacggtggggtcggtggccaccaggtccgg 465
|||||||| |||| ||||| ||||| || |||||
Sbjct: 1470 aacgacaccgtggcatcggtcgccacgagatccgg 1436
>gb|CF387319.1|CF387319 RTDR1_12_E06.b1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_12_E06_A015 3', mRNA
sequence
Length = 600
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 162 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 116
>gb|CF387433.1|CF387433 RTDR1_12_E06.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_12_E06_A015 5', mRNA
sequence
Length = 733
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 539 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 493
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 332 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 280
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 182 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 127
>gb|CF402695.1|CF402695 RTWW1_22_F07.b1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_22_F07_A015 3', mRNA sequence
Length = 670
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 210 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 164
>gb|CF402721.1|CF402721 RTWW1_22_F07.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_22_F07_A015 5', mRNA sequence
Length = 787
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 515 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 469
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 331 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 279
>gb|CF666076.1|CF666076 RTCNT1_20_C05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_20_C05_A029 5', mRNA sequence
Length = 642
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 564 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 518
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 357 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 305
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 207 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 152
>gb|CF666519.1|CF666519 RTCNT1_23_H08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_23_H08_A029 5', mRNA sequence
Length = 576
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 537 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 491
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 330 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 278
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 180 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 125
>gb|CF667167.1|CF667167 RTCNT1_28_C08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_28_C08_A029 5', mRNA sequence
Length = 882
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 572 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 526
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 365 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 313
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 215 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 160
>gb|CF669441.1|CF669441 RTCNT1_43_H11.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_43_H11_A029 3', mRNA sequence
Length = 527
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 67 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 21
>gb|CO157933.1|CO157933 FLD1_3_D12.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_3_D12_A029 3', mRNA sequence
Length = 766
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 309 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 263
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 102 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 50
>gb|CO159873.1|CO159873 FLD1_16_C10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_16_C10_A029 5', mRNA sequence
Length = 773
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 428 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 382
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 218 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 166
>gb|CO160475.1|CO160475 FLD1_21_F04.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_21_F04_A029 3', mRNA sequence
Length = 667
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 222 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 176
>gb|CO160542.1|CO160542 FLD1_21_F04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_21_F04_A029 5', mRNA sequence
Length = 839
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 569 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 523
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 362 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 310
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 212 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 157
>gb|CO162720.1|CO162720 FLD1_37_C10.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_37_C10_A029 3', mRNA sequence
Length = 813
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 353 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 307
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 146 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 94
>gb|CO162801.1|CO162801 FLD1_37_C10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_37_C10_A029 5', mRNA sequence
Length = 879
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 561 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 515
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 354 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 302
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 204 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 149
>gb|CO163830.1|CO163830 FLD1_44_C01.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_44_C01_A029 3', mRNA sequence
Length = 848
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 294 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 340
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 504 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 556
>gb|CO163908.1|CO163908 FLD1_44_C01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_44_C01_A029 5', mRNA sequence
Length = 871
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 444 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 490
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 654 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 706
>gb|CO165084.1|CO165084 FLD1_52_F07.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_52_F07_A029 3', mRNA sequence
Length = 904
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 317 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 363
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 527 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 579
>gb|CO165159.1|CO165159 FLD1_52_F07.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_52_F07_A029 5', mRNA sequence
Length = 839
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 442 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 488
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 652 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 704
>gb|CO166724.1|CO166724 FLD1_64_C04.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_64_C04_A029 3', mRNA sequence
Length = 778
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 336 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 290
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 129 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 77
>gb|CO167135.1|CO167135 FLD1_67_C06.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_67_C06_A029 3', mRNA sequence
Length = 786
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 325 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 279
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 118 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 66
>gb|CO167207.1|CO167207 FLD1_67_C06.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_67_C06_A029 5', mRNA sequence
Length = 824
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 438 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 392
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 231 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 179
>gb|CO167667.1|CO167667 FLD1_70_H11.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_70_H11_A029 3', mRNA sequence
Length = 763
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 305 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 259
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 95 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 43
>gb|CO172154.1|CO172154 NDL1_27_E05.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_27_E05_A029 5', mRNA sequence
Length = 722
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 544 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 498
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 337 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 285
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 187 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 132
>gb|CO196977.1|CO196977 GEO1_3_B12.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_3_B12_A029 3', mRNA sequence
Length = 759
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 168 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 214
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 375 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 427
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 525 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 580
>gb|CO197047.1|CO197047 GEO1_3_B12.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_3_B12_A029 5', mRNA sequence
Length = 797
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 433 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 479
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 640 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 692
>gb|CO197540.1|CO197540 GEO1_7_E10.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_7_E10_A029 3', mRNA sequence
Length = 691
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 243 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 197
>gb|CO197612.1|CO197612 GEO1_7_E10.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_7_E10_A029 5', mRNA sequence
Length = 695
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 239 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 193
>gb|CO198371.1|CO198371 GEO1_13_E06.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_13_E06_A029 3', mRNA sequence
Length = 763
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 318 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 272
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 111 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 59
>gb|CO200358.1|CO200358 GEO2_7_A10.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_7_A10_A032 3', mRNA sequence
Length = 806
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 361 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 315
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 154 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 102
>gb|CO364991.1|CO364991 RTK1_23_B02.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_23_B02_A029 3', mRNA sequence
Length = 864
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 395 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 349
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 185 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 133
>gb|CO365069.1|CO365069 RTK1_23_B02.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_23_B02_A029 5', mRNA sequence
Length = 884
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 540 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 494
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 330 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 278
>gb|CO366964.1|CO366964 RTK1_31_G06.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_31_G06_A029 3', mRNA sequence
Length = 900
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 351 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 397
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 558 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 610
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 708 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 763
>gb|CO367045.1|CO367045 RTK1_31_G06.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_31_G06_A029 5', mRNA sequence
Length = 745
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 547 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 593
>gb|CX647196.1|CX647196 COLD1_14_F07.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_14_F07_A029 3', mRNA sequence
Length = 754
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 175 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 221
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 382 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 434
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 532 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 587
>gb|DR013674.1|DR013674 HEAT1_20_F12.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_20_F12_A029 5', mRNA sequence
Length = 803
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 366 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 320
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 159 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 107
>gb|DR016318.1|DR016318 STRS1_9_H09.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_9_H09_A034 3', mRNA sequence
Length = 741
Score = 61.9 bits (31), Expect = 5e-008
Identities = 58/67 (86%)
Strand = Plus / Minus
Query: 353 gtccactgccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccag 412
||||||| ||| ||||||||||||||||| || ||||| || || |||| |||||||||
Sbjct: 413 gtccacttccctgtcatgacgtcgtggcaggaaggctttggagattgcgcggtcatccag 354
Query: 413 aaccaga 419
|||||||
Sbjct: 353 aaccaga 347
Score = 46.1 bits (23), Expect = 0.003
Identities = 53/63 (84%)
Strand = Plus / Minus
Query: 175 gcagtccaagttgtcgccgtagctgaccccaagcaagtcacagtatcgtttgtagaagcc 234
|||||||| |||| | || |||||||| ||||| | |||||| ||||| | |||||||||
Sbjct: 591 gcagtccaggttggctccatagctgacgccaagaatgtcacaatatcgctggtagaagcc 532
Query: 235 gat 237
|||
Sbjct: 531 gat 529
>gb|DR021485.1|DR021485 STRS1_45_B01.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_45_B01_A034 3', mRNA sequence
Length = 621
Score = 61.9 bits (31), Expect = 5e-008
Identities = 58/67 (86%)
Strand = Plus / Minus
Query: 353 gtccactgccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccag 412
||||||| ||| ||||||||||||||||| || ||||| || || |||| |||||||||
Sbjct: 264 gtccacttccctgtcatgacgtcgtggcaggaaggctttggagattgcgcggtcatccag 205
Query: 413 aaccaga 419
|||||||
Sbjct: 204 aaccaga 198
Score = 46.1 bits (23), Expect = 0.003
Identities = 53/63 (84%)
Strand = Plus / Minus
Query: 175 gcagtccaagttgtcgccgtagctgaccccaagcaagtcacagtatcgtttgtagaagcc 234
|||||||| |||| | || |||||||| ||||| | |||||| ||||| | |||||||||
Sbjct: 442 gcagtccaggttggctccatagctgacgccaagaatgtcacaatatcgctggtagaagcc 383
Query: 235 gat 237
|||
Sbjct: 382 gat 380
>gb|DR023069.1|DR023069 STRS1_55_F11.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_55_F11_A034 3', mRNA sequence
Length = 836
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 376 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 330
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 169 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 117
>gb|DR023151.1|DR023151 STRS1_55_F11.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_55_F11_A034 5', mRNA sequence
Length = 834
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 504 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 458
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 297 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 245
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 147 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 92
>gb|DR048493.1|DR048493 RTBOR1_9_F08.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_9_F08_A029 3', mRNA sequence
Length = 721
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 266 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 220
>gb|DR068847.1|DR068847 RTDK1_3_F06.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_3_F06_A029 3', mRNA sequence
Length = 655
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 226 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 180
>gb|DR068935.1|DR068935 RTDK1_3_F06.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_3_F06_A029 5', mRNA sequence
Length = 831
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 568 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 522
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 361 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 309
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 211 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 156
>gb|DR071414.1|DR071414 RTDK1_19_E08.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_19_E08_A029 5', mRNA sequence
Length = 464
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 364 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 410
>gb|DR071614.1|DR071614 RTDK1_21_B07.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_21_B07_A029 3', mRNA sequence
Length = 661
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 202 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 156
>gb|DR072750.1|DR072750 RTDK1_28_G11.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_28_G11_A029 3', mRNA sequence
Length = 649
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 215 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 169
>gb|DR093284.1|DR093284 STRR1_7_F10.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_7_F10_A033 3', mRNA sequence
Length = 901
Score = 61.9 bits (31), Expect = 5e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 365 gtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaaccaga 419
||||||||||||||||| || |||||||| || |||| ||||||||||||||||
Sbjct: 456 gtcatgacgtcgtggcaggaaggcttgggagattgcgcggtcatccagaaccaga 510
Score = 54.0 bits (27), Expect = 1e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 175 gcagtccaagttgtcgccgtagctgaccccaagcaagtcacagtatcgtttgtagaagcc 234
|||||||| |||| | || |||||||| ||||| | |||||| ||||| |||||||||||
Sbjct: 266 gcagtccaggttggctccatagctgacgccaagaatgtcacaatatcgcttgtagaagcc 325
Query: 235 gat 237
|||
Sbjct: 326 gat 328
>gb|DR093363.1|DR093363 STRR1_7_F10.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_7_F10_A033 5', mRNA sequence
Length = 782
Score = 61.9 bits (31), Expect = 5e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 365 gtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaaccaga 419
||||||||||||||||| || |||||||| || |||| ||||||||||||||||
Sbjct: 460 gtcatgacgtcgtggcaggaaggcttgggagattgcgcggtcatccagaaccaga 514
Score = 54.0 bits (27), Expect = 1e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 175 gcagtccaagttgtcgccgtagctgaccccaagcaagtcacagtatcgtttgtagaagcc 234
|||||||| |||| | || |||||||| ||||| | |||||| ||||| |||||||||||
Sbjct: 270 gcagtccaggttggctccatagctgacgccaagaatgtcacaatatcgcttgtagaagcc 329
Query: 235 gat 237
|||
Sbjct: 330 gat 332
>gb|DR095288.1|DR095288 STRR1_20_C04.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_C04_A033 3', mRNA sequence
Length = 883
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 435 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 389
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 228 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 176
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 78 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 23
>gb|DR095362.1|DR095362 STRR1_20_C04.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_C04_A033 5', mRNA sequence
Length = 914
Score = 61.9 bits (31), Expect = 5e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
|||||||||||||| ||||| || ||||||| |||||||||||||||
Sbjct: 570 acgtcgtggcacgaaggcttcggagactgcgccgtcatccagaacca 524
Score = 42.1 bits (21), Expect = 0.049
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 629 ttgaagcagtagccccaggcgtagggcccgtcgggcgccgtcgcccacccgcc 681
||||||||||| ||||| || || || ||||| || ||||| |||||||||||
Sbjct: 363 ttgaagcagtaaccccacgcatatgggccgtctggggccgttgcccacccgcc 311
Score = 40.1 bits (20), Expect = 0.19
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 779 gccgcgatgaagcccgcgtaggtgtagaagccgttggcggggcacgccgcgtcgtt 834
||||| |||||| | | ||||||||||||||| || || ||||| || ||||||||
Sbjct: 213 gccgcaatgaaggcggtgtaggtgtagaagcctttcgccgggcatgcggcgtcgtt 158
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 118,806
Number of Sequences: 355925
Number of extensions: 118806
Number of successful extensions: 37248
Number of sequences better than 0.5: 615
Number of HSP's better than 0.5 without gapping: 615
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35458
Number of HSP's gapped (non-prelim): 1790
length of query: 1141
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1122
effective length of database: 210,514,662
effective search space: 236197450764
effective search space used: 236197450764
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)