BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3438088.2.1
(615 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BM492367.1|BM492367 NXRV_023_D01_F NXRV (Nsf Xylem Root ... 40 0.10
gb|BQ700793.1|BQ700793 NXRV111_D08_F NXRV (Nsf Xylem Root w... 38 0.41
gb|CF392038.1|CF392038 RTDR3_12_E04.g1_A022 Loblolly pine r... 38 0.41
>gb|BM492367.1|BM492367 NXRV_023_D01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_023_D01 5', mRNA sequence
Length = 210
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 ataccataccataccatacc 221
||||||||||||||||||||
Sbjct: 87 ataccataccataccatacc 106
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 ataccataccataccatacc 221
||||||||||||||||||||
Sbjct: 82 ataccataccataccatacc 101
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 ataccataccataccatacc 221
||||||||||||||||||||
Sbjct: 77 ataccataccataccatacc 96
>gb|BQ700793.1|BQ700793 NXRV111_D08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV111_D08 5' similar to Arabidopsis thaliana
sequence At5g49720 cellulase homolog OR16pep precursor
(pir||S71215) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 352
Score = 38.2 bits (19), Expect = 0.41
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 491 ccacttccaccctcctttgcagc 513
||||||||| |||||||||||||
Sbjct: 141 ccacttccatcctcctttgcagc 119
>gb|CF392038.1|CF392038 RTDR3_12_E04.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_12_E04_A022 5', mRNA
sequence
Length = 699
Score = 38.2 bits (19), Expect = 0.41
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 250 ccggcggcggcggaggcgaagggaaca 276
|||||||||||||||| | ||||||||
Sbjct: 395 ccggcggcggcggaggaggagggaaca 421
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,318
Number of Sequences: 355925
Number of extensions: 68318
Number of successful extensions: 22524
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22515
Number of HSP's gapped (non-prelim): 9
length of query: 615
length of database: 217,277,237
effective HSP length: 19
effective length of query: 596
effective length of database: 210,514,662
effective search space: 125466738552
effective search space used: 125466738552
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)