BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF25f04.yg.3.3
(1599 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC146575.3| Medicago truncatula clone mth2-145m4, comple... 90 7e-016
gb|AC144806.10| Medicago truncatula clone mth2-34h22, compl... 80 7e-013
gb|CB893792.1|CB893792 EST646584 HOGA Medicago truncatula c... 60 6e-007
emb|CR483668.1| mth2-151A17RM1 BAC end, cultivar Jemalong A... 56 1e-005
gb|CG965866.1|CG965866 MBEIP01TR mth2 Medicago truncatula g... 54 4e-005
emb|CR968741.1| mth4-27K18RM1 BAC end, cultivar Jemalong A1... 42 0.14
>gb|AC146575.3| Medicago truncatula clone mth2-145m4, complete sequence
Length = 117113
Score = 89.7 bits (45), Expect = 7e-016
Identities = 114/137 (83%)
Strand = Plus / Minus
Query: 238 aagagggaaaccctaaagttgatcgagacttttgtggacaaggcggaagatttgccacat 297
|||||||| || || ||| |||| ||||| ||| |||||||||| |||||| |||||
Sbjct: 45855 aagagggagacacttaagctgattgagacatttttggacaaggctgaagatcaaccacaa 45796
Query: 298 gtaggaaagcagtttgtaccaccaatgatggatcctgttcttggtgattatgctagaaat 357
| ||||| || ||||| ||||||||||||||||||||||| || |||||||| || |||
Sbjct: 45795 attggaaaacaatttgtgccaccaatgatggatcctgttctgggagattatgccaggaat 45736
Query: 358 gtacccgatgcaaggga 374
|| || |||||||||||
Sbjct: 45735 gtgcctgatgcaaggga 45719
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 736 tttttgacaattgagcaagagatttttgcagtcctcacagacacattccataaacctggt 795
||||||||||| ||||||||||| ||||| ||| | |||||||| || ||||| |||||
Sbjct: 44632 tttttgacaatagagcaagagatatttgctgtcttgacagacacttttcataagcctggg 44573
Query: 796 ttcaa 800
|||||
Sbjct: 44572 ttcaa 44568
Score = 46.1 bits (23), Expect = 0.009
Identities = 77/95 (81%)
Strand = Plus / Minus
Query: 589 cagcaattgaagcttgtgatcgattcaattaattgggcgttcagacatacagagagaaat 648
|||||| ||||| |||| || |||||||| | ||||| || | |||||||| ||||||
Sbjct: 45010 cagcaactgaagtttgttatggattcaatcatatgggcatttcggcatacagaaagaaat 44951
Query: 649 attgcagagactggccttagcctgttgttggagat 683
||||| || ||||| || | ||| |||||||||||
Sbjct: 44950 attgctgaaactggtctgaaccttttgttggagat 44916
Score = 42.1 bits (21), Expect = 0.14
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 479 agatgattactaagaactttgaagattatcctgagca 515
|||||||||| || |||||||||||||| || |||||
Sbjct: 45248 agatgattacgaaaaactttgaagattacccagagca 45212
>gb|AC144806.10| Medicago truncatula clone mth2-34h22, complete sequence
Length = 124550
Score = 79.8 bits (40), Expect = 7e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 1072 caggataacaaggatctatacgcggaagaggctgctgcccaaagagaaagggagcgccaa 1131
||||||||||| ||||| || || ||||||||||| || || |||||||| || || |||
Sbjct: 51765 caggataacaaagatctctatgctgaagaggctgcggctcagagagaaagagaacggcaa 51706
Query: 1132 cgaatgcttgccattccggggctgattgcccctagcgaattgcaagacgagatggt 1187
|||||||| | ||||| |||||||||||||| | ||| |||||||| || |||||
Sbjct: 51705 agaatgctttctattccagggctgattgccccaatcgagttgcaagatgaaatggt 51650
Score = 77.8 bits (39), Expect = 3e-012
Identities = 135/167 (80%)
Strand = Plus / Minus
Query: 238 aagagggaaaccctaaagttgatcgagacttttgtggacaaggcggaagatttgccacat 297
|||||||| || || || ||||||||||| || |||| ||||| |||||| |||||
Sbjct: 53825 aagagggagacacttaaattgatcgagacattcttggataaggctgaagatcaaccacag 53766
Query: 298 gtaggaaagcagtttgtaccaccaatgatggatcctgttcttggtgattatgctagaaat 357
| ||||| || ||||| || |||||||||||||||||||| || ||||||||||| |||
Sbjct: 53765 attggaaaacaatttgtgccgccaatgatggatcctgttctgggagattatgctaggaat 53706
Query: 358 gtacccgatgcaagggagtctgaagttctgtccttgtttgcaacaat 404
| || ||||||||||| || || ||| ||||| | ||||| |||||
Sbjct: 53705 gctcctgatgcaagggaatcagaggttttgtccctttttgccacaat 53659
Score = 56.0 bits (28), Expect = 1e-005
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 479 agatgattactaagaactttgaagattatcctgagcaccg 518
|||||||||| || |||||||||||||| |||||||||||
Sbjct: 53074 agatgattacaaaaaactttgaagattaccctgagcaccg 53035
Score = 56.0 bits (28), Expect = 1e-005
Identities = 79/96 (82%)
Strand = Plus / Minus
Query: 588 tcagcaattgaagcttgtgatcgattcaattaattgggcgttcagacatacagagagaaa 647
|||||||||||||||||| || |||||||| | ||||| || | || ||||| || ||
Sbjct: 52856 tcagcaattgaagcttgttatggattcaatcatgtgggcatttcggcacacagaaaggaa 52797
Query: 648 tattgcagagactggccttagcctgttgttggagat 683
|||||| || || ||||| | |||||||||||||||
Sbjct: 52796 tattgctgaaacaggcctgaacctgttgttggagat 52761
>gb|CB893792.1|CB893792 EST646584 HOGA Medicago truncatula cDNA clone HOGA-29C15, mRNA
sequence
Length = 873
Score = 60.0 bits (30), Expect = 6e-007
Identities = 99/122 (81%)
Strand = Plus / Plus
Query: 583 tcaagtcagcaattgaagcttgtgatcgattcaattaattgggcgttcagacatacagag 642
|||||||||||| ||||| |||| || |||||||| | ||||| || | ||||||||
Sbjct: 102 tcaagtcagcaactgaagtttgttatggattcaatcatatgggcatttcggcatacagaa 161
Query: 643 agaaatattgcagagactggccttagcctgttgttggagatcttgaaaaaattccaggct 702
||||||||||| || ||||| || | ||| ||||||||||| |||| || || ||||||
Sbjct: 162 agaaatattgctgaaactggtctgaaccttttgttggagatgctgaacaagtttcaggct 221
Query: 703 tc 704
||
Sbjct: 222 tc 223
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 736 tttttgacaattgagcaagagatttttgcagtcctcacagacacattccataaacctggt 795
||||||||||| ||||||||||| ||||| ||| | |||||||| || ||||| |||||
Sbjct: 255 tttttgacaatagagcaagagatatttgctgtcttgacagacacttttcataagcctggg 314
Query: 796 ttcaa 800
|||||
Sbjct: 315 ttcaa 319
Score = 56.0 bits (28), Expect = 1e-005
Identities = 85/104 (81%)
Strand = Plus / Plus
Query: 1060 gagttctcagctcaggataacaaggatctatacgcggaagaggctgctgcccaaagagaa 1119
||||| ||||||||||||||||| ||||| || || ||||| || || || || |||||
Sbjct: 585 gagttttcagctcaggataacaaagatctttatgccgaagaagccgcagctcagagagag 644
Query: 1120 agggagcgccaacgaatgcttgccattccggggctgattgcccc 1163
|| || || ||| |||||||| | ||||| ||||| ||||||||
Sbjct: 645 agagaacggcaaagaatgctttctattccagggcttattgcccc 688
>emb|CR483668.1| mth2-151A17RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 689
Score = 56.0 bits (28), Expect = 1e-005
Identities = 79/96 (82%)
Strand = Plus / Minus
Query: 588 tcagcaattgaagcttgtgatcgattcaattaattgggcgttcagacatacagagagaaa 647
|||||||||||||||||| || |||||||| | ||||| || | || ||||| || ||
Sbjct: 679 tcagcaattgaagcttgttatggattcaatcatgtgggcatttcggcacacagaaaggaa 620
Query: 648 tattgcagagactggccttagcctgttgttggagat 683
|||||| || || ||||| | |||||||||||||||
Sbjct: 619 tattgctgaaacaggcctgaacctgttgttggagat 584
>gb|CG965866.1|CG965866 MBEIP01TR mth2 Medicago truncatula genomic clone 63B2, DNA sequence
Length = 901
Score = 54.0 bits (27), Expect = 4e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 736 tttttgacaattgagcaagagatttttgcagtcctcacagacacattccataaacctgg 794
||||||||||| ||||||||||| ||||| ||| | |||||||| || ||||| |||||
Sbjct: 842 tttttgacaatagagcaagagatatttgctgtcttgacagacacttttcataagcctgg 900
Score = 46.1 bits (23), Expect = 0.009
Identities = 77/95 (81%)
Strand = Plus / Plus
Query: 589 cagcaattgaagcttgtgatcgattcaattaattgggcgttcagacatacagagagaaat 648
|||||| ||||| |||| || |||||||| | ||||| || | |||||||| ||||||
Sbjct: 464 cagcaactgaagtttgttatggattcaatcatatgggcatttcggcatacagaaagaaat 523
Query: 649 attgcagagactggccttagcctgttgttggagat 683
||||| || ||||| || | ||| |||||||||||
Sbjct: 524 attgctgaaactggtctgaaccttttgttggagat 558
Score = 42.1 bits (21), Expect = 0.14
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 479 agatgattactaagaactttgaagattatcctgagca 515
|||||||||| || |||||||||||||| || |||||
Sbjct: 226 agatgattacgaaaaactttgaagattacccagagca 262
>emb|CR968741.1| mth4-27K18RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 408
Score = 42.1 bits (21), Expect = 0.14
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 479 agatgattactaagaactttgaagattatcctgagca 515
|||||||||| || |||||||||||||| || |||||
Sbjct: 231 agatgattacgaaaaactttgaagattacccagagca 267
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 454,969
Number of Sequences: 392609
Number of extensions: 454969
Number of successful extensions: 35028
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34980
Number of HSP's gapped (non-prelim): 44
length of query: 1599
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1579
effective length of database: 433,880,813
effective search space: 685097803727
effective search space used: 685097803727
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)