BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3802544.2.1
(814 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO517063.1|CO517063 s13dSG31H0600058_468672 Glandular tr... 86 4e-017
gb|CO516412.1|CO516412 s13dSG27D0900076_446152 Glandular tr... 78 1e-014
gb|CO512559.1|CO512559 s13dSG08E0900067_121044 Glandular tr... 50 2e-006
gb|CO515541.1|CO515541 s13dSG53C0200018_418141 Glandular tr... 46 4e-005
>gb|CO517063.1|CO517063 s13dSG31H0600058_468672 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 495
Score = 85.7 bits (43), Expect = 4e-017
Identities = 88/103 (85%)
Strand = Plus / Minus
Query: 376 tttgagtcaagatgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggat 435
||||||| | ||||||||||||||| ||||| |||| |||||||||||| | |||||||
Sbjct: 316 tttgagtgaggatgttttctggtggccttatatatattgtcttgttcaacgttcgaggat 257
Query: 436 catcaacagacttgattgtatacgttgcaacatcgtcttcatc 478
|||||| | ||| ||||| || ||||||||||| ||||||||
Sbjct: 256 catcaattgtcttaattgtgtatgttgcaacatcatcttcatc 214
Score = 46.1 bits (23), Expect = 4e-005
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 651 tcatcaaatgtaacccttcctggttcaagagcatg 685
||||||||||| || |||||||||||||| |||||
Sbjct: 42 tcatcaaatgtgactcttcctggttcaagtgcatg 8
Score = 42.1 bits (21), Expect = 6e-004
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 209 ttcaaaatttgtcaagcaaccttcatagaaaat 241
||||||||||||||| || |||||| |||||||
Sbjct: 483 ttcaaaatttgtcaaacacccttcaaagaaaat 451
>gb|CO516412.1|CO516412 s13dSG27D0900076_446152 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 456
Score = 77.8 bits (39), Expect = 1e-014
Identities = 111/135 (82%)
Strand = Plus / Minus
Query: 376 tttgagtcaagatgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggat 435
||||||| | ||||||||||||||| |||| |||| |||||||||||||| ||||| |
Sbjct: 138 tttgagtgaggatgttttctggtggccttagatatattgtcttgttcaatgttcgagggt 79
Query: 436 catcaacagacttgattgtatacgttgcaacatcgtcttcatcacagaatatagctttga 495
|||||| | ||| ||||| || ||||||||||| |||||||| || | | ||||||
Sbjct: 78 catcaattgtcttaattgtgtatgttgcaacatcatcttcatccataaaaacaactttga 19
Query: 496 cattgccgtctccat 510
|||||||||| ||||
Sbjct: 18 cattgccgtcgccat 4
Score = 46.1 bits (23), Expect = 4e-005
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 207 atttcaaaatttgtcaagcaaccttcatagaaaat 241
||||||||||||| ||| || ||||||||||||||
Sbjct: 307 atttcaaaatttgccaaacacccttcatagaaaat 273
>gb|CO512559.1|CO512559 s13dSG08E0900067_121044 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 573
Score = 50.1 bits (25), Expect = 2e-006
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 651 tcatcaaatgtaacccttcctggttcaagagcatgccccat 691
||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 461 tcatcaaatgtgactcttcctggttcaagtgcatgtcccat 421
>gb|CO515541.1|CO515541 s13dSG53C0200018_418141 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 539
Score = 46.1 bits (23), Expect = 4e-005
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 651 tcatcaaatgtaacccttcctggttcaagagcatg 685
||||||||||| || |||||||||||||| |||||
Sbjct: 465 tcatcaaatgtgactcttcctggttcaagtgcatg 431
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1904
Number of Sequences: 7669
Number of extensions: 1904
Number of successful extensions: 575
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 564
Number of HSP's gapped (non-prelim): 11
length of query: 814
length of database: 3,745,706
effective HSP length: 16
effective length of query: 798
effective length of database: 3,623,002
effective search space: 2891155596
effective search space used: 2891155596
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)