BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3802264.2.1
(1189 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
ref|NM_102134.2| Arabidopsis thaliana hydrolase, hydrolyzin... 54 6e-005
ref|NM_001036005.1| Arabidopsis thaliana hydrolase, hydroly... 54 6e-005
emb|BX816127.1|CNS0ADYJ Arabidopsis thaliana Full-length cD... 48 0.004
gb|U17888.1|ATU17888 Arabidopsis thaliana beta-glucanase mR... 46 0.014
gb|AY086043.1| Arabidopsis thaliana clone 20797 mRNA, compl... 46 0.014
emb|BX816524.1|CNS0AAUM Arabidopsis thaliana Full-length cD... 46 0.014
emb|BX816994.1|CNS0ADD7 Arabidopsis thaliana Full-length cD... 46 0.014
ref|NM_105807.1| Arabidopsis thaliana hydrolase, hydrolyzin... 46 0.014
gb|CC459435.1|CC459435 SALK_129834.48.20.x Arabidopsis thal... 44 0.055
gb|CC796249.1|CC796249 SALK_128538.53.00.x Arabidopsis thal... 44 0.055
gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, c... 44 0.055
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 44 0.055
gb|AY075630.1| Arabidopsis thaliana At1g22880/F19G10_16 mRN... 44 0.055
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 44 0.055
emb|AL035394.1|ATF9D16 Arabidopsis thaliana DNA chromosome ... 44 0.055
emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosom... 44 0.055
ref|NM_118487.2| Arabidopsis thaliana hydrolase, hydrolyzin... 44 0.055
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 44 0.055
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.055
>ref|NM_102134.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT1G22880 transcript variant AT1G22880.1 mRNA, complete
cds
Length = 1893
Score = 54.0 bits (27), Expect = 6e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| |||||||| ||||||||
Sbjct: 941 ttctactgctcctactctggctacaaggacgagct 975
>ref|NM_001036005.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT1G22880 transcript variant AT1G22880.2 mRNA, complete
cds
Length = 1974
Score = 54.0 bits (27), Expect = 6e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| |||||||| ||||||||
Sbjct: 1022 ttctactgctcctactctggctacaaggacgagct 1056
>emb|BX816127.1|CNS0ADYJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH2ZB08 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1617
Score = 48.1 bits (24), Expect = 0.004
Identities = 34/36 (94%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactc-gggctacaacgacgagct 179
||||||||||||||||| ||||||||| ||||||||
Sbjct: 685 ttctactgctcctactctgggctacaaggacgagct 720
>gb|U17888.1|ATU17888 Arabidopsis thaliana beta-glucanase mRNA, partial cds
Length = 1629
Score = 46.1 bits (23), Expect = 0.014
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| || ||||| ||||||||
Sbjct: 661 ttctactgctcctactctggttacaaggacgagct 695
>gb|AY086043.1| Arabidopsis thaliana clone 20797 mRNA, complete sequence
Length = 1700
Score = 46.1 bits (23), Expect = 0.014
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| || ||||| ||||||||
Sbjct: 713 ttctactgctcctactctggttacaaggacgagct 747
>emb|BX816524.1|CNS0AAUM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH53ZG08 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1593
Score = 46.1 bits (23), Expect = 0.014
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| || ||||| ||||||||
Sbjct: 681 ttctactgctcctactctggttacaaggacgagct 715
>emb|BX816994.1|CNS0ADD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH7ZF09 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1585
Score = 46.1 bits (23), Expect = 0.014
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| || ||||| ||||||||
Sbjct: 667 ttctactgctcctactctggttacaaggacgagct 701
>ref|NM_105807.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT1G71380 mRNA, complete cds
Length = 1700
Score = 46.1 bits (23), Expect = 0.014
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaacgacgagct 179
||||||||||||||||| || ||||| ||||||||
Sbjct: 713 ttctactgctcctactctggttacaaggacgagct 747
>gb|CC459435.1|CC459435 SALK_129834.48.20.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_129834.48.20.x,
DNA sequence
Length = 452
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 186 ttctactgctcctactctggctacaa 161
>gb|CC796249.1|CC796249 SALK_128538.53.00.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_128538.53.00.x,
DNA sequence
Length = 416
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 203 ttctactgctcctactctggctacaa 178
>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence
Length = 92948
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 74518 ttctactgctcctactctggctacaa 74493
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 8096277 ttctactgctcctactctggctacaa 8096302
>gb|AY075630.1| Arabidopsis thaliana At1g22880/F19G10_16 mRNA sequence
Length = 2059
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 1022 ttctactgctcctactctggctacaa 1047
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 44.1 bits (22), Expect = 0.055
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 139 tgccccttctactgctcctactcgggctac 168
||||| ||||||||||||||||| ||||||
Sbjct: 8207580 tgccctttctactgctcctactccggctac 8207551
>emb|AL035394.1|ATF9D16 Arabidopsis thaliana DNA chromosome 4, BAC clone F9D16 (ESSAII
project)
Length = 119430
Score = 44.1 bits (22), Expect = 0.055
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 139 tgccccttctactgctcctactcgggctac 168
||||| ||||||||||||||||| ||||||
Sbjct: 12602 tgccctttctactgctcctactccggctac 12573
>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
Length = 199199
Score = 44.1 bits (22), Expect = 0.055
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 139 tgccccttctactgctcctactcgggctac 168
||||| ||||||||||||||||| ||||||
Sbjct: 148392 tgccctttctactgctcctactccggctac 148363
>ref|NM_118487.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT4G23560 mRNA, complete cds
Length = 1741
Score = 44.1 bits (22), Expect = 0.055
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 139 tgccccttctactgctcctactcgggctac 168
||||| ||||||||||||||||| ||||||
Sbjct: 652 tgccctttctactgctcctactccggctac 681
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 44.1 bits (22), Expect = 0.055
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 139 tgccccttctactgctcctactcgggctac 168
||||| ||||||||||||||||| ||||||
Sbjct: 12294819 tgccctttctactgctcctactccggctac 12294790
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.055
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 145 ttctactgctcctactcgggctacaa 170
||||||||||||||||| ||||||||
Sbjct: 8096512 ttctactgctcctactctggctacaa 8096537
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 288,750
Number of Sequences: 1013581
Number of extensions: 288750
Number of successful extensions: 19670
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 19331
Number of HSP's gapped (non-prelim): 340
length of query: 1189
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1169
effective length of database: 888,669,252
effective search space: 1038854355588
effective search space used: 1038854355588
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)