BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3713002.2.1
(923 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 42 0.17
gb|AC069160.7|AC069160 Arabidopsis thaliana chromosome 1 BA... 42 0.17
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.17
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 atgtatatatatggtatatgt 609
|||||||||||||||||||||
Sbjct: 12931355 atgtatatatatggtatatgt 12931335
>gb|AC069160.7|AC069160 Arabidopsis thaliana chromosome 1 BAC T9I1 genomic sequence, complete
sequence
Length = 99241
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 atgtatatatatggtatatgt 609
|||||||||||||||||||||
Sbjct: 14360 atgtatatatatggtatatgt 14340
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.17
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 atgtatatatatggtatatgt 609
|||||||||||||||||||||
Sbjct: 12922559 atgtatatatatggtatatgt 12922539
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 310,251
Number of Sequences: 1013581
Number of extensions: 310251
Number of successful extensions: 25716
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25415
Number of HSP's gapped (non-prelim): 301
length of query: 923
length of database: 908,940,872
effective HSP length: 20
effective length of query: 903
effective length of database: 888,669,252
effective search space: 802468334556
effective search space used: 802468334556
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)