BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493645.2.1
(870 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|B20339.1|B20339 F16C23-Sp6 IGF Arabidopsis thaliana geno... 42 0.16
gb|AA389770.1|AA389770 OS037 NaCl-treated Arabidopsis subtr... 42 0.16
gb|R90352.1|R90352 16707 Lambda-PRL2 Arabidopsis thaliana c... 42 0.16
gb|N96082.1|N96082 21395 CD4-15 Arabidopsis thaliana cDNA c... 42 0.16
gb|AV824557.1|AV824557 AV824557 RAFL6 Arabidopsis thaliana ... 42 0.16
gb|CB256857.1|CB256857 58-E011664-027-006-C16-T7R MPIZ-ADIS... 42 0.16
gb|CK117555.1|CK117555 216a01.p1 AtM1 Arabidopsis thaliana ... 42 0.16
gb|BP817955.1|BP817955 BP817955 RAFL19 Arabidopsis thaliana... 42 0.16
gb|BP835436.1|BP835436 BP835436 RAFL19 Arabidopsis thaliana... 42 0.16
gb|BP843440.1|BP843440 BP843440 RAFL21 Arabidopsis thaliana... 42 0.16
gb|BP846132.1|BP846132 BP846132 RAFL21 Arabidopsis thaliana... 42 0.16
gb|BP846800.1|BP846800 BP846800 RAFL21 Arabidopsis thaliana... 42 0.16
gb|BP862875.1|BP862875 BP862875 RAFL21 Arabidopsis thaliana... 42 0.16
emb|AX507791.1| Sequence 2486 from Patent WO0216655 42 0.16
emb|AX651358.1| Sequence 148 from Patent WO03000898 42 0.16
gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II s... 42 0.16
emb|BX827391.1|CNS0A2DD Arabidopsis thaliana Full-length cD... 42 0.16
ref|NM_127297.4| Arabidopsis thaliana NTRA AT2G17420 (NTRA)... 42 0.16
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.16
>gb|B20339.1|B20339 F16C23-Sp6 IGF Arabidopsis thaliana genomic clone F16C23, DNA
sequence
Length = 775
Score = 42.1 bits (21), Expect = 0.16
Identities = 28/29 (96%), Gaps = 1/29 (3%)
Strand = Plus / Plus
Query: 257 ggcctcctcttcttcctcgtcctcctcct 285
|||||||||||||||||| ||||||||||
Sbjct: 730 ggcctcctcttcttcctc-tcctcctcct 757
>gb|AA389770.1|AA389770 OS037 NaCl-treated Arabidopsis subtraction library Arabidopsis
thaliana cDNA 5' similar to Thioredoxin reductase, mRNA
sequence
Length = 483
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 111 tcttcttcctcgtcctcctcc 131
>gb|R90352.1|R90352 16707 Lambda-PRL2 Arabidopsis thaliana cDNA clone 192M6T7, mRNA
sequence
Length = 434
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 37 tcttcttcctcgtcctcctcc 57
>gb|N96082.1|N96082 21395 CD4-15 Arabidopsis thaliana cDNA clone G1C8T7, mRNA sequence
Length = 567
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 62 tcttcttcctcgtcctcctcc 82
>gb|AV824557.1|AV824557 AV824557 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-72-E13 5',
mRNA sequence
Length = 401
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 41 tcttcttcctcgtcctcctcc 61
>gb|CB256857.1|CB256857 58-E011664-027-006-C16-T7R MPIZ-ADIS-027 Arabidopsis thaliana cDNA
clone MPIZp772C166Q 5-PRIME, mRNA sequence
Length = 464
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 39 tcttcttcctcgtcctcctcc 59
>gb|CK117555.1|CK117555 216a01.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011A01216
5-PRIME, mRNA sequence
Length = 457
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 33 tcttcttcctcgtcctcctcc 53
>gb|BP817955.1|BP817955 BP817955 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-46-I05 5',
mRNA sequence
Length = 389
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 50 tcttcttcctcgtcctcctcc 70
>gb|BP835436.1|BP835436 BP835436 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-13-G04 5',
mRNA sequence
Length = 389
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 117 tcttcttcctcgtcctcctcc 137
>gb|BP843440.1|BP843440 BP843440 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-58-D05 5',
mRNA sequence
Length = 399
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 104 tcttcttcctcgtcctcctcc 124
>gb|BP846132.1|BP846132 BP846132 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-95-O10 5',
mRNA sequence
Length = 402
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 103 tcttcttcctcgtcctcctcc 123
>gb|BP846800.1|BP846800 BP846800 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-98-E13 5',
mRNA sequence
Length = 405
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 106 tcttcttcctcgtcctcctcc 126
>gb|BP862875.1|BP862875 BP862875 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-64-L18 5',
mRNA sequence
Length = 379
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 49 tcttcttcctcgtcctcctcc 69
>emb|AX507791.1| Sequence 2486 from Patent WO0216655
Length = 1152
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 121 tcttcttcctcgtcctcctcc 141
>emb|AX651358.1| Sequence 148 from Patent WO03000898
Length = 1152
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 121 tcttcttcctcgtcctcctcc 141
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
sequence. Sequence from clones T23A1, F5J6, MJB20
Length = 76170
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 65279 tcttcttcctcgtcctcctcc 65299
>emb|BX827391.1|CNS0A2DD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS4ZD10 of Adult vegetative tissue of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1377
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 259 cctcctcttcttcctcgtcctcctc 283
|||||||||||||||| ||||||||
Sbjct: 1071 cctcctcttcttcctcctcctcctc 1047
>ref|NM_127297.4| Arabidopsis thaliana NTRA AT2G17420 (NTRA) mRNA, complete cds
Length = 1469
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 118 tcttcttcctcgtcctcctcc 138
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 264 tcttcttcctcgtcctcctcc 284
|||||||||||||||||||||
Sbjct: 7571544 tcttcttcctcgtcctcctcc 7571564
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 302,245
Number of Sequences: 1013581
Number of extensions: 302245
Number of successful extensions: 30675
Number of sequences better than 0.5: 20
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 30520
Number of HSP's gapped (non-prelim): 153
length of query: 870
length of database: 908,940,872
effective HSP length: 20
effective length of query: 850
effective length of database: 888,669,252
effective search space: 755368864200
effective search space used: 755368864200
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)