BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2188214.2.1
(880 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AL942357.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.16
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.16
emb|AL161542.2|ATCHRIV42 Arabidopsis thaliana DNA chromosom... 42 0.16
emb|Z97339.2|ATFCA4 Arabidopsis thaliana DNA chromosome 4, ... 42 0.16
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.16
>emb|AL942357.1| Arabidopsis thaliana T-DNA flanking sequence GK-265D01-014990,
genomic survey sequence
Length = 375
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 589 gggtgttgtatgacttgcaattctg 613
||||||||||||||||||| |||||
Sbjct: 143 gggtgttgtatgacttgcatttctg 119
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 589 gggtgttgtatgacttgcaattctg 613
||||||||||||||||||| |||||
Sbjct: 4806508 gggtgttgtatgacttgcatttctg 4806532
>emb|AL161542.2|ATCHRIV42 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 42
Length = 195068
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 589 gggtgttgtatgacttgcaattctg 613
||||||||||||||||||| |||||
Sbjct: 19466 gggtgttgtatgacttgcatttctg 19490
>emb|Z97339.2|ATFCA4 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 4
Length = 205065
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 589 gggtgttgtatgacttgcaattctg 613
||||||||||||||||||| |||||
Sbjct: 62412 gggtgttgtatgacttgcatttctg 62436
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 589 gggtgttgtatgacttgcaattctg 613
||||||||||||||||||| |||||
Sbjct: 8893765 gggtgttgtatgacttgcatttctg 8893789
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 333,980
Number of Sequences: 1013581
Number of extensions: 333980
Number of successful extensions: 26241
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25931
Number of HSP's gapped (non-prelim): 310
length of query: 880
length of database: 908,940,872
effective HSP length: 20
effective length of query: 860
effective length of database: 888,669,252
effective search space: 764255556720
effective search space used: 764255556720
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)